ORFeome > clec3a ORF1 – XORFeome v1.0

clec3a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: clec3a
Gene ID: 986192
Gene Page ID: 986190
ORF Xenbase ID: 17269839

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078559
Original XGC clone length: 582

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ839850
dbEST ID: 79657552
Trimmed Sequence: ATGGCACAGGCTGGACTTCTCATTTGGCTCTTCTTTACCATACTTCTATTGGATCTGACATGCACACAATCTGCCAAATTAAAGACACAGAAGGACCACAGATCTAAGGAGAAAGATGGTGATCTGAAGACACAAATTGACAAGCTGTGGCGAGAGATTAATTCTCTGAAGGAAATGCAGGCATTACAGACAGTCTGTCTGCGTGGTACCAAAATTCATAAAAAGTGTTACCTGTCATTTGAAGAAACCAAGCACTTCCATGAAGCTAATGAGGACTGCATAGCCAAAGGAGGAACCCTGGCAATTCCTAGAGATTCTGAGGAGAACAATGCTCTCCGGGACTATGGAAAGAAGAGCCTTCATGGTTCTGGAGAGTTTTGGCTAGGTATTAATGATATGGTAAATGAGGGAAAGTTTGTGGATGTTAATGGTGTTGCCATAACCTATTTCAATTGGAAACGCATACCTAAAGGGGGAAAGCGTAAAAATTGTGCTCTCCTGAATCAAGCTTCCCAANGTAAATGGGTTGACAAAGTGTGTCCTAATTTAAAAAAATATATCTGTGAATTTATTATCCCTTTGCCAACTTTCTTGTACAAAGTTGACATTAGGGAAAAACATTGGCTATCAAGATTTTTGTCACAAAGAGGTACACAATCAGTTCAAAAAAAAATCATTATTTGCCATCCCGCCTCAAATCCCCCAATACTTAAAATCCTAAAAAAAAAAAAAAAAAAAAAAATTTTAACACAAATCCAGCCCACAGCGCCCCCGAAAAAAAAAAAGAAAAAACAAACTCCCAAAACCAGGGGGTCCCTGGGTG
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACAGGCTGGACTTCTCATTTGGCTCTTCTTTACCATACTTCTATTGGATCTGACATGCACACAATCTGCCAAATTAAAGACACAGAAGGACCACAGATCTAAGGAGAAAGATGGTGATCTGAAGACACAAATTGACAAGCTGTGGCGAGAGATTAATTCTCTGAAGGAAATGCAGGCATTACAGACAGTCTGTCTGCGTGGTACCAAAATTCATAAAAAGTGTTACCTGTCATTTGAAGAAACCAAGCACTTCCATGAAGCTAATGAGGACTGCATAGCCAAAGGAGGAACCCTGGCAATTCCTAGAGATTCTGAGGAGAACAATGCTCTCCGGGACTATGGAAAGAAGAGCCTTCATGGTTCTGGAGAGTTTTGGCTAGGTATTAATGATATGGTAAATGAGGGAAAGTTTGTGGATGTTAATGGTGTTGCCATAACCTATTTCAATTGGAAACGCATACCTAAAGGGGGAAAGCGTAAAAATTGTGCTCTCCTGAATCAAGCTTCCCAANGTAAATGGGTTGACAAAGTGTGTCCTAATTTAAAAAAATATATCTGTGAATTTATTATCCCTTTGCCAACTTTCTTGTACAAAGTTGACATTAGGGAAAAACATTGGCTATCAAGATTTTTGTCACAAAGAGGTACACAATCAGTTCAAAAAAAAATCATTATTTGCCATCCCGCCTCAAATCCCCCAATACTTAAAATCCTAAAAAAAAAAAAAAAAAAAAAAATTTTAACACAAATCCAGCCCACAGCGCCCCCGAAAAAAAAAAAGAAAAAACAAACTCCCAAAACCAGGGGGTCCCTGGGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACAGGCTGGACTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839849
dbEST ID: 79657551
Trimmed Sequence: AGGGATAATAAACTCACAGATATATTTCTTTAAACTACGACACACTTCGTCAACCCATTTACCTTGGGAAGCCTGATTCAGGAGAGCACAATTTTTACGCTTTCCCCCTTTAGGTATGCGTTCCCAATTGAAATAGGTTATGGCAACACCATTAACATCCACAAACTTTCCCTCATTTACCATATCATTAATACCTAGCCAAAACTCTCCAGAACCATGAAGGCTCTTCTTTCCATAGTCCCGGAGAGCATTGTTCTCCTCAGAATCTCTAGGAATTGCCAGGGTTCCTCCTTTGGCTATGCAGTCCTCATTAGCTTCATGGAAGTGCTTGGTTTCTTCAAATGACAGGTAACACTTTTTATGAATTTTGGTACCACGCAGACAGACTGTCTGTAATGCCTGCATTTCCTTCAGAGAATTAATCTCTCGCCACAGCTTGTCAATTTGTGTCTTCAGATCACCATCTTTCTCCTTAGATCTGTGGTCCTTCTGTGTCTTTAATTTGGCAGATTGTGTGCATGTCAGATCCAATAGAAGTATGGTAAAGAAGAGCCAAATGAGAAGTCCAGCCTGTGCCATGG
Full Trace Sequence: GCCCGTGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGGATAATAAACTCACAGATATATTTCTTTAAACTACGACACACTTCGTCAACCCATTTACCTTGGGAAGCCTGATTCAGGAGAGCACAATTTTTACGCTTTCCCCCTTTAGGTATGCGTTCCCAATTGAAATAGGTTATGGCAACACCATTAACATCCACAAACTTTCCCTCATTTACCATATCATTAATACCTAGCCAAAACTCTCCAGAACCATGAAGGCTCTTCTTTCCATAGTCCCGGAGAGCATTGTTCTCCTCAGAATCTCTAGGAATTGCCAGGGTTCCTCCTTTGGCTATGCAGTCCTCATTAGCTTCATGGAAGTGCTTGGTTTCTTCAAATGACAGGTAACACTTTTTATGAATTTTGGTACCACGCAGACAGACTGTCTGTAATGCCTGCATTTCCTTCAGAGAATTAATCTCTCGCCACAGCTTGTCAATTTGTGTCTTCAGATCACCATCTTTCTCCTTAGATCTGTGGTCCTTCTGTGTCTTTAATTTGGCAGATTGTGTGCATGTCAGATCCAATAGAAGTATGGTAAAGAAGAGCCAAATGAGAAGTCCAGCCTGTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGGCTTATAAAAAAAGCATGCTCATCAAATTGTTGCACGAACAAGGTCACTATCAATCAAAAAAAAATCATTATTAGGGGCCCGAAGCTAAAAAATGGCCGTCGTAGAACAAAAAACGCAGAAACACGTGGGGAAAGGGGTCCCGGGGTTAACAAACACGTTGTTACCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGGATAATAAACTCACAGAT