ORFeome > cryba4 ORF2 – XORFeome v1.0

cryba4 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cryba4
Gene ID: 6256521
Gene Page ID: 998931
ORF Xenbase ID: 17270877

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106620
Original XGC clone length: 645

Human orthology & disease relationships

NCBI Entrez ID: 1413
Ensembl gene IDs: ENSG00000196431
Directly associated (OMIM) disease MIM numbers: 610425
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ837742
dbEST ID: 79655444
Trimmed Sequence: ATGGAAATTTCCCCAGTACAGACTGAGAGAGAAAACTTCACAAAGAAAATGGCCGAGACCAACCCACTCTCCATGCGTATGGGATCCTGGAAGATCACAGTCTATGACCAGGAGAACTTCCAAGGAAAAAGGATGGAATTCTCTTCCTCCTGCCAAAACATCATGGAATGTGGCTTTGACAACATCAGATCTCTAAAGGTGGAGTGTGGAGCATGGATAGGCTATGAGCACACAAGCTTCTGCGGTCAGCAGTTTGTCCTGGAAAAAGGAGAATACCCAAGGTGGGAGGCCTGGAGTGGAAGCAACGCTTATCATGTGGAACGCATGATGTCCTTCCGCCCAATCTGTGGTGCTAACCACAAGGAATCCAAGCTGATGGTTTTTGAGAAAGAGAATTTCATTGGACGCAAGTGGGACATGTGTGATGACTATCCCTCTCTGCAAGCTATGGGATGGTTCAACAATGAGGTTGGATCCATGAAAGTAACGAGTGGAGCCTGGGTGTGCTACCAGTATCCTGGTTATCGTGGTTACCAGTACATTTTGGAGTGTGACCACCATGGAGGTGAATACAAGCCCTGGAGAGAGTGGGGGATCCCATGCCCAGACCTTCCAGGTCCAGTCTATCCCACCCTTTCAGCCGTTGCCACCTTTCCTTGTACAGGTTGCATTATAAGAAAGCCTTTCTTTATCTATTTTTTTTCACCGGACAGGTCCCCTATCATTCAAAATAAAATCCCTTATTTTC
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAATTTCCCCAGTACAGACTGAGAGAGAAAACTTCACAAAGAAAATGGCCGAGACCAACCCACTCTCCATGCGTATGGGATCCTGGAAGATCACAGTCTATGACCAGGAGAACTTCCAAGGAAAAAGGATGGAATTCTCTTCCTCCTGCCAAAACATCATGGAATGTGGCTTTGACAACATCAGATCTCTAAAGGTGGAGTGTGGAGCATGGATAGGCTATGAGCACACAAGCTTCTGCGGTCAGCAGTTTGTCCTGGAAAAAGGAGAATACCCAAGGTGGGAGGCCTGGAGTGGAAGCAACGCTTATCATGTGGAACGCATGATGTCCTTCCGCCCAATCTGTGGTGCTAACCACAAGGAATCCAAGCTGATGGTTTTTGAGAAAGAGAATTTCATTGGACGCAAGTGGGACATGTGTGATGACTATCCCTCTCTGCAAGCTATGGGATGGTTCAACAATGAGGTTGGATCCATGAAAGTAACGAGTGGAGCCTGGGTGTGCTACCAGTATCCTGGTTATCGTGGTTACCAGTACATTTTGGAGTGTGACCACCATGGAGGTGAATACAAGCCCTGGAGAGAGTGGGGGATCCCATGCCCAGACCTTCCAGGTCCAGTCTATCCCACCCTTTCAGCCGTTGCCACCTTTCCTTGTACAGGTTGCATTATAAGAAAGCCTTTCTTTATCTATTTTTTTTCACCGGACAGGTCCCCTATCATTCAAAATAAAATCCCTTATTTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAATTTCCCCAGTACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837741
dbEST ID: 79655443
Trimmed Sequence: CTGCTGAATGCGTCGGATAGACTGGACCTGGAAGGTCTGGGCATGGGATCCCCACTCTCTCCAGTGCTTGTATTCACCTCCATGGTGGTCACACTCCAAAATGTACTGGTAACCACGATAACCAGGATACTGGTAGCACACCCAGGCTCCACTCGTTACTTTCATGGATCCAACCTCATTGTTGAACCATCCCATAGCTTGCAGAGAGGGATAGTCATCACACATGTCCCACTTGCGTCCAATGAAATTCTCTTTCTCAAAAACCATCAGCTTGGATTCCTTGTGGTTAGCACCACAGATTGGGCGGAAGGACATCATGCGTTCCACATGATAAGCGTTGCTTCCACTCCAGGCCTCCCACCTTGGGTATTCTCCTTTTTCCAGGACAAACTGCTGACCGCAGAAACTTGTGTGCTCATAGCCTATCCGTGCTCCACACTCCACCTTTAGAGATCTGATGTTGTCAAAGCCACATTCCATGATGTTTTGGCGGGAGGAAGAGAATTCCATCCTTTTTCCGTGGAAATTCTCCTGGTCGTAAACTGTGATCTTCCACGATCCGCTACCCATGCAGAGTGGGTTGGTCTCGCCCTTTTCTTTGTGGGGTTTCTCTCTGGTCTGTACTGGGGGAAGGTACTTGGAGGGGGGTTAATTTACAGATTAGGATTGGAGAAAGCATTCTCGTGGGTTTGTGGTGGGGGCAGGGGGGGGTGNGTAAAAAAAAAAAAAAAAAGAAAAGAGGAATAAGAATTAGAGGTGTTTAAAAAAGCCGGGGAAAAAAAAAGCGGGTTCGTGGCTACAAGGGGCCTGGGTATTAGCCGGTGGAGGACGAGGGAGGGCCGAACGCGGGGGGAAGAACCGGGTGGGGGAGGGGGGGGGAGGAGGGGGGGGGGGGGGGCGGGGGGGGGGGGAAAAAAGAAAAAAAAAAAAGAAAAAAAACANAGAAGAAAAAAAGAGAAGGGGNGGAGGGGGAGGNGGGGGGANGGNGNGNAAGAGGAAAAAGAAAAAAGNAAAAAAAGGNGNGGAGNNNGGGNGNNGNNGGNAGNNNGNNNAGNGGGGAGGGGNGGAGGNNAGNGNGGGGGNNGGGGAANGAAAAAGANAGAAAAGGGGGAGNNNGGNNGNNNNGGANN
Full Trace Sequence: GGGCGGGGAACAGCCACGGAAGAAGCGAAAAGGAGACACACGAGGGGAAGAGAGCGCGGAGGGCAAAAGACGAGATATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGCTGAATGCGTCGGATAGACTGGACCTGGAAGGTCTGGGCATGGGATCCCCACTCTCTCCAGTGCTTGTATTCACCTCCATGGTGGTCACACTCCAAAATGTACTGGTAACCACGATAACCAGGATACTGGTAGCACACCCAGGCTCCACTCGTTACTTTCATGGATCCAACCTCATTGTTGAACCATCCCATAGCTTGCAGAGAGGGATAGTCATCACACATGTCCCACTTGCGTCCAATGAAATTCTCTTTCTCAAAAACCATCAGCTTGGATTCCTTGTGGTTAGCACCACAGATTGGGCGGAAGGACATCATGCGTTCCACATGATAAGCGTTGCTTCCACTCCAGGCCTCCCACCTTGGGTATTCTCCTTTTTCCAGGACAAACTGCTGACCGCAGAAACTTGTGTGCTCATAGCCTATCCGTGCTCCACACTCCACCTTTAGAGATCTGATGTTGTCAAAGCCACATTCCATGATGTTTTGGCGGGAGGAAGAGAATTCCATCCTTTTTCCGTGGAAATTCTCCTGGTCGTAAACTGTGATCTTCCACGATCCGCTACCCATGCAGAGTGGGTTGGTCTCGCCCTTTTCTTTGTGGGGTTTCTCTCTGGTCTGTACTGGGGGAAGGTACTTGGAGGGGGGTTAATTTACAGATTAGGATTGGAGAAAGCATTCTCGTGGGTTTGTGGTGGGGGCAGGGGGGGGTGNGTAAAAAAAAAAAAAAAAAGAAAAGAGGAATAAGAATTAGAGGTGTTTAAAAAAGCCGGGGAAAAAAAAAGCGGGTTCGTGGCTACAAGGGGCCTGGGTATTAGCCGGTGGAGGACGAGGGAGGGCCGAACGCGGGGGGAAGAACCGGGTGGGGGAGGGGGGGGGAGGAGGGGGGGGGGGGGGGCGGGGGGGGGGGGAAAAAAGAAAAAAAAAAAAGAAAAAAAACANAGAAGAAAAAAAGAGAAGGGGNGGAGGGGGAGGNGGGGGGANGGNGNGNAAGAGGAAAAAGAAAAAAGNAAAAAAAGGNGNGGAGNNNGGGNGNNGNNGGNAGNNNGNNNAGNGGGGAGGGGNGGAGGNNAGNGNGGGGGNNGGGGAANGAAAAAGANAGAAAAGGGGGAGNNNGGNNGNNNNGGANN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCTGAATGCGTCGGAT