ORFeome > crygd ORF1 – XORFeome v1.0

crygd ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: crygd
Gene ID: 6254321
Gene Page ID: 989443
ORF Xenbase ID: 17270925

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078626
Original XGC clone length: 525

Human orthology & disease relationships

NCBI Entrez ID: 1421
Ensembl gene IDs: ENSG00000118231
Directly associated (OMIM) disease MIM numbers: 115700
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ839852
dbEST ID: 79657554
Trimmed Sequence: ATGGGAAAGATAATCTTCTACGAAGACAGAAACTTCCAGGGTCGCTCATATGAGTGCAATTCTGAATGTCCAGACATGTCCTCAAATTTTAGACGCTGCAACTCCATTCGAGTGGAAAGTGGAGACTGGATTCTCTATGAACATCCCAATTACAGAGGGCATCAATACTACCTCCGTAGGGGGGAATATCCTGATTTCCAGCAATGGATGGGTTTCAATGACTGCATTAAATCCTGCCGCCTGAGCCCACAGCACCAAGGATCTTTTAGAATGAAGATCTATGAGAGAGAGGATTTCAGAGGTCAGATGATGGAGTTCACTGAAGATTGTCCCAATGTCTATGAGAGATTTAATTTCCAGGATATCCACTCCTGCCAAGTCCTTGATGGTTATTGGATGTTTTATGAAGAACCCAACTACAGGGGACGTCAATACTATCTGAGGCCTGGAGAGTACAGGAGATACACTGATTGGGGAGCCATGAACCCCAGAATTGGCTCCTTTAGACATGTTTATCATCGCTT
Full Trace Sequence: GGGTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGATAATCTTCTACGAAGACAGAAACTTCCAGGGTCGCTCATATGAGTGCAATTCTGAATGTCCAGACATGTCCTCAAATTTTAGACGCTGCAACTCCATTCGAGTGGAAAGTGGAGACTGGATTCTCTATGAACATCCCAATTACAGAGGGCATCAATACTACCTCCGTAGGGGGGAATATCCTGATTTCCAGCAATGGATGGGTTTCAATGACTGCATTAAATCCTGCCGCCTGAGCCCACAGCACCAAGGATCTTTTAGAATGAAGATCTATGAGAGAGAGGATTTCAGAGGTCAGATGATGGAGTTCACTGAAGATTGTCCCAATGTCTATGAGAGATTTAATTTCCAGGATATCCACTCCTGCCAAGTCCTTGATGGTTATTGGATGTTTTATGAAGAACCCAACTACAGGGGACGTCAATACTATCTGAGGCCTGGAGAGTACAGGAGATACACTGATTGGGGAGCCATGAACCCCAGAATTGGCTCCTTTAGACATGTTTATCATCGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTTGTTGCCATCCGACTAAATTCCCCTAATATGAGTCGTAATACAGGGTCCTAACTAAAAAATGGAAACTTCTGGCCCAGGTTTCAAATTTCCCAAAAGTTAAAAAANAAAANNAAAAAAATGTTNNTATNNNTTTTTTTTTTTTTTATATATCCTATTTGGGNNNTAGAAAACCCTCGAGGTTATTATTCTCTAANN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGATAATCTTCTACGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839851
dbEST ID: 79657553
Trimmed Sequence: GCGATGATAAACATGTCTAAAGGAGCCAATTCTGGGGTTCATGGCTCCCCAATCAGTGTATCTCCTGTACTCTCCAGGCCTCAGATAGTATTGACGTCCCCTGTAGTTGGGTTCTTCATAAAACATCCAATAACCATCAAGGACTTGGCAGGAGTGGATATCCTGGAAATTAAATCTCTCATAGACATTGGGACAATCTTCAGTGAACTCCATCATCTGACCTCTGAAATCCTCTCTCTCATAGATCTTCATTCTAAAAGATCCTTGGTGCTGTGGGCTCAGGCGGCAGGATTTAATGCAGTCATTGAAACCCATCCATTGCTGGAAATCAGGATATTCCCCCCTACGGAGGTAGTATTGATGCCCTCTGTAATTGGGCTGTTCATAGAGAATCCAGTCTCCACTTTCCACTCGAATGGAGTTGCAGCGTCTAAAATTTGAGGACATGTCTGGACATTCAGAATTGCACTCATATGAGCGACCCTGGAAGTTTCTGTCTTCATAGAAAATTATCTTTCCCATGG
Full Trace Sequence: GAAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGATGATAAACATGTCTAAAGGAGCCAATTCTGGGGTTCATGGCTCCCCAATCAGTGTATCTCCTGTACTCTCCAGGCCTCAGATAGTATTGACGTCCCCTGTAGTTGGGTTCTTCATAAAACATCCAATAACCATCAAGGACTTGGCAGGAGTGGATATCCTGGAAATTAAATCTCTCATAGACATTGGGACAATCTTCAGTGAACTCCATCATCTGACCTCTGAAATCCTCTCTCTCATAGATCTTCATTCTAAAAGATCCTTGGTGCTGTGGGCTCAGGCGGCAGGATTTAATGCAGTCATTGAAACCCATCCATTGCTGGAAATCAGGATATTCCCCCCTACGGAGGTAGTATTGATGCCCTCTGTAATTGGGCTGTTCATAGAGAATCCAGTCTCCACTTTCCACTCGAATGGAGTTGCAGCGTCTAAAATTTGAGGACATGTCTGGACATTCAGAATTGCACTCATATGAGCGACCCTGGAAGTTTCTGTCTTCATAGAAAATTATCTTTCCCATGGTGCCAACTTTTTTGTACAAAGTTGGATTATAAAAAAGCATTGCTCATCATTTTGTTGCAACGAACAGGTCCTATCAGTCAAAATAAAATCATTATATGAGGCCCCGAACTTAAAATGGCCCTCGTTTTACCCGCCCTGGACTGGGATTTTCCCTGAAAGCTCTGGCCCGTTTTCAAAATCCCCTGTAGTTAACAACCACCCTTCTTCAATAANAAAAACTTAAATATGTCCNAACTTTTTATGGTGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGATGATAAACATGTCTAAAGG