ORFeome > cyhr1 ORF1 – XORFeome v1.0

cyhr1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cyhr1
Gene ID: 5917347
Gene Page ID: 5917344
ORF Xenbase ID: 17271579

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC122465
Original XGC clone length: 1098

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ838021
dbEST ID: 79655723
Trimmed Sequence: ATGTCTGAAGAGCGGGAGGCACCGGGGCCACTGGCCTCTTCCTCGGCGGGTCTGGGAGCGGAAGTGGGGCAGGAGGAAGTCCCCGGGGGAGCGGGTCCGGCTCGGCTGTTGTTACTCCCCTCAGACTCGGACGGGCCGCCCAAGAAGCGACTGCGCTCAGAGGCCGAGCCCGGGAGTGTCCGGCTGGAGGAGAGACTGTACTCGGTGCTGTGCTGTGCCGTCTGCCTGGACCTGCCCAAAGCCTCTGTGTATCAGTGCACTAATGGGCACCTCATGTGCGCCGGCTGCTTTATCCACCTCCTGGCAGATGCTCGGCTTAAGGAAGAGCAGGCCACTTGCCCTAACTGCCGCTGTGAGATTAGTAAAAGTTTGTGCTGCAGGAATCTGGCCGTGGAGAAGGCCATCAGTGAGCTGCCATCAGATTGTGGCTTCTGCCTAAAGCAGTTTCCCCCTTCTTTGCTGGAAAGGCACAAGAAGGAGGAGTGTCAGGACAGGGTAGCTCAATGCAGGTACAAAAGGATCGGGTGCCCATGGCAGGGGCCGGTTCATGAGCTGACAATGCATGAGTCTGAATGCTGACACCCTACCAAAACCTGCAATGAGGTGATGGAGATCTGGGGAGAGAGGGAACAATCGCCCCAAAAAAAAAAACAGTTGTTGGACGCGAATCTTTTTCCTTTTTTAGCTTTGGGAGGAGCGGATAAGGAGAAGGGACGGGGTCGGGGGGTTCCGGAACCAAATAAAAAAAATAACCAATTCTTTTCTCGGAGGGGAGCCGGGACCTCACCCCCATTCCCAACTCCCAACCCTGTGTTTTCTAAA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGAAGAGCGGGAGGCACCGGGGCCACTGGCCTCTTCCTCGGCGGGTCTGGGAGCGGAAGTGGGGCAGGAGGAAGTCCCCGGGGGAGCGGGTCCGGCTCGGCTGTTGTTACTCCCCTCAGACTCGGACGGGCCGCCCAAGAAGCGACTGCGCTCAGAGGCCGAGCCCGGGAGTGTCCGGCTGGAGGAGAGACTGTACTCGGTGCTGTGCTGTGCCGTCTGCCTGGACCTGCCCAAAGCCTCTGTGTATCAGTGCACTAATGGGCACCTCATGTGCGCCGGCTGCTTTATCCACCTCCTGGCAGATGCTCGGCTTAAGGAAGAGCAGGCCACTTGCCCTAACTGCCGCTGTGAGATTAGTAAAAGTTTGTGCTGCAGGAATCTGGCCGTGGAGAAGGCCATCAGTGAGCTGCCATCAGATTGTGGCTTCTGCCTAAAGCAGTTTCCCCCTTCTTTGCTGGAAAGGCACAAGAAGGAGGAGTGTCAGGACAGGGTAGCTCAATGCAGGTACAAAAGGATCGGGTGCCCATGGCAGGGGCCGGTTCATGAGCTGACAATGCATGAGTCTGAATGCTGACACCCTACCAAAACCTGCAATGAGGTGATGGAGATCTGGGGAGAGAGGGAACAATCGCCCCAAAAAAAAAAACAGTTGTTGGACGCGAATCTTTTTCCTTTTTTAGCTTTGGGAGGAGCGGATAAGGAGAAGGGACGGGGTCGGGGGGTTCCGGAACCAAATAAAAAAAATAACCAATTCTTTTCTCGGAGGGGAGCCGGGACCTCACCCCCATTCCCAACTCCCAACCCTGTGTTTTCTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGAAGAGCGGGAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838020
dbEST ID: 79655722
Trimmed Sequence: CTTTTGGATCTGGAATATAAAGAGCCGGAGGTTGATGTTCTTTGCAGCCAGCAGTTTGTTACATTCCACAGAGTCTATGATGGGCAGCGGCACATACTCAGTCTCGTTGTTCTCATTGGTGAACACAAATTGGTAGATGACGGGGTGTATTTTGACATCGTCATAAGGGCCTTTGAGAAGTAAGAAGGAACACTCCATGGGGGAGTTGACTTTGCTCTTTAGGATGAGTTGGAAGGATAGGGTACGCTTGCATGACAAATTGGGGTTCCTCTCAGAATCATTAACACAATCCTTAAACACCCACGTCTGATTGAAAACAGTGAATCGCGGTGTCTCGTACTACAGACGGGTAATGAAGTCATCGGTTCTGTAAGGGCGGGGCGGTATCTCTCTGTAACCGATCTTCTCCTAGCTCAGGAGGCTGGGGATACAGTTGTGGGAGGTGATCTCTGTCTTGTTCGTGGGGTCCATGTCACCGATCATCTCGCCCAGCTCGGTGCCAGTTTGATGTAAGGTAGCAGGGGGGGCACTCACCCACTGTCGGCTCATGACATGGGGGCGGGGCGGGGGGGCCGGGGGGAATAAGTATTGGCATCGAGTTAGACATCTCCTCAGCTGCTCCGTTCCTTTTCCTTTTCGTGCGCGTAGCGGGGAGAAGGGGTTGGGGAGGGAGGGGGGGAGGTGATCCCAACCTCGATGGAGGGATGTTCTCTCTCCCTTNTAATCCGCGCGGGGGCCGAGGCCGCCCGCGGCTCCTAAAAATCCTTCATTATTA
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTTGGATCTGGAATATAAAGAGCCGGAGGTTGATGTTCTTTGCAGCCAGCAGTTTGTTACATTCCACAGAGTCTATGATGGGCAGCGGCACATACTCAGTCTCGTTGTTCTCATTGGTGAACACAAATTGGTAGATGACGGGGTGTATTTTGACATCGTCATAAGGGCCTTTGAGAAGTAAGAAGGAACACTCCATGGGGGAGTTGACTTTGCTCTTTAGGATGAGTTGGAAGGATAGGGTACGCTTGCATGACAAATTGGGGTTCCTCTCAGAATCATTAACACAATCCTTAAACACCCACGTCTGATTGAAAACAGTGAATCGCGGTGTCTCGTACTACAGACGGGTAATGAAGTCATCGGTTCTGTAAGGGCGGGGCGGTATCTCTCTGTAACCGATCTTCTCCTAGCTCAGGAGGCTGGGGATACAGTTGTGGGAGGTGATCTCTGTCTTGTTCGTGGGGTCCATGTCACCGATCATCTCGCCCAGCTCGGTGCCAGTTTGATGTAAGGTAGCAGGGGGGGCACTCACCCACTGTCGGCTCATGACATGGGGGCGGGGCGGGGGGGCCGGGGGGAATAAGTATTGGCATCGAGTTAGACATCTCCTCAGCTGCTCCGTTCCTTTTCCTTTTCGTGCGCGTAGCGGGGAGAAGGGGTTGGGGAGGGAGGGGGGGAGGTGATCCCAACCTCGATGGAGGGATGTTCTCTCTCCCTTNTAATCCGCGCGGGGGCCGAGGCCGCCCGCGGCTCCTAAAAATCCTTCATTATTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTGGATCTGGAATATAAAGAG