ORFeome > dbp ORF1 – XORFeome v1.0

dbp ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: dbp
Gene ID: 6256610
Gene Page ID: 5995285
ORF Xenbase ID: 17271903

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC054981
Original XGC clone length: 837

Human orthology & disease relationships

NCBI Entrez ID: 1628
Ensembl gene IDs: ENSG00000105516
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,259500,300367

Library Location

Plate ID: GDExl11001
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ839225
dbEST ID: 79656927
Trimmed Sequence: ATGTCCCAGACTGAGAGCATCAGGGGATTCCTGGATATTCCAGAGATGCTGAAATCACTCTTAGACTACCCCCTCCCTCAGAATGGAACAGAGAAAGACAAGACCAAATTGGACAAAGATGATGATCATGATAGTATGGTGGCCTCTGCATCACTCATGCCCCCCATCTGGGACAAAACCATTCCCTATGATGGAGAGTCATTTCACCTTGAGTATATGGACCTAGATGAGTTCTTACTGGAGAATGGAATCCCTTCCAGCCCAACACAGCTTTCCCAAGCCATTCAGACCATTCCACTTATGCCTGTAGTGGAGCTTGAATGTGACAATGAACCAGCTTCAACTTCATCTGCCTCACCGATGTCTCCCTCTGTACTGCTGGGGAACTCAGAAGTTGAAGATTCTGACTTAGAGGACGAGGAAGACCCTCCTAGTCCTGTTGATCCAGAAAAGGTAGAGGTAGAAGTGAACTTTAACCCAGATCCAACAGATCTTTTGCTCTCCAGTGTGCCTGGTGGGGAACTTTTTGATCCCAGGAAGCATAGGTTTGCAGAGGAGGAGCTGAGACCTCAACCCATGATCAAGAAGGCCAAGAAAATATATGTCTCAAAAGAAAGGAAGGATGAAAAATACTGGAATAGGCGGAAGAAAACAATATTGCAGCCAAGCGGTTCCGTGATGCCCGACGAATCAAAAAAAATCAGATCACCGTCCCGGGC
Full Trace Sequence: CCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCCAGACTGAGAGCATCAGGGGATTCCTGGATATTCCAGAGATGCTGAAATCACTCTTAGACTACCCCCTCCCTCAGAATGGAACAGAGAAAGACAAGACCAAATTGGACAAAGATGATGATCATGATAGTATGGTGGCCTCTGCATCACTCATGCCCCCCATCTGGGACAAAACCATTCCCTATGATGGAGAGTCATTTCACCTTGAGTATATGGACCTAGATGAGTTCTTACTGGAGAATGGAATCCCTTCCAGCCCAACACAGCTTTCCCAAGCCATTCAGACCATTCCACTTATGCCTGTAGTGGAGCTTGAATGTGACAATGAACCAGCTTCAACTTCATCTGCCTCACCGATGTCTCCCTCTGTACTGCTGGGGAACTCAGAAGTTGAAGATTCTGACTTAGAGGACGAGGAAGACCCTCCTAGTCCTGTTGATCCAGAAAAGGTAGAGGTAGAAGTGAACTTTAACCCAGATCCAACAGATCTTTTGCTCTCCAGTGTGCCTGGTGGGGAACTTTTTGATCCCAGGAAGCATAGGTTTGCAGAGGAGGAGCTGAGACCTCAACCCATGATCAAGAAGGCCAAGAAAATATATGTCTCAAAAGAAAGGAAGGATGAAAAATACTGGAATAGGCGGAAGAAAACAATATTGCAGCCAAGCGGTTCCGTGATGCCCGACGAATCAAAAAAAATCAGATCACCGTCCCGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCCAGACTGAGAGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ839224
dbEST ID: 79656926
Trimmed Sequence: CAACAGTCCACACTGCGTTTCGTATTTGGAAATGATGTTCCTGCATTTGCCCAGCTCTTTACGGAGGTCGGCCACCTCTGAGCGCAGTGCTGTGTTTTCTTTTTCCAGGAAGGCTGCCCGGACGGTGATCTGATTTTCTTTGAGTCGTCGGGCATCACGGGAACGCTTGGCTGCAATATTGTTCTTCTTCCGCCTATTCCAGTATTTTTCATCCTTCCTTTCTTCTGAGACATATATTTTCTTGGCCTTCTTGATCATGGGTTGAGGTTTCAGCTCCTCCTCTGCAAACCTATGCTTCCTGGGATCAAAAAGTTCCCCACCAGGCACACTGGAGAGCAAAAGATCTGTTGGATCTGGGTTAAAGTTCACTTCTACCTCTACCTTTTCTGGATCAACAGGACTAGGAGGGTCTTCCTCGTCCTCTAAGTCAGAATCTTCAACTTCTGAGTTCCCCAGCAGTACAGAGGGAGACATCGGTGAGGCAGATGAAGTTGAAGCTGGTTCATTGTCACATTCAAGCTCCACTACAGGCATAAGTGGAATGGTCTGAATGGCTTGGGAAAGCTGTGTTGGGCTGGAAGGGATTCCATTCTCCAGTAAGAACTCATCTAGGTCCATATACTCAAGGTGAAATGACTCTCCATCAAAGGGAAATGGTTTTGTCCCCAAATGGGGGGGCATGAATTGATGCAAAAGC
Full Trace Sequence: CGTGCAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAACAGTCCACACTGCGTTTCGTATTTGGAAATGATGTTCCTGCATTTGCCCAGCTCTTTACGGAGGTCGGCCACCTCTGAGCGCAGTGCTGTGTTTTCTTTTTCCAGGAAGGCTGCCCGGACGGTGATCTGATTTTCTTTGAGTCGTCGGGCATCACGGGAACGCTTGGCTGCAATATTGTTCTTCTTCCGCCTATTCCAGTATTTTTCATCCTTCCTTTCTTCTGAGACATATATTTTCTTGGCCTTCTTGATCATGGGTTGAGGTTTCAGCTCCTCCTCTGCAAACCTATGCTTCCTGGGATCAAAAAGTTCCCCACCAGGCACACTGGAGAGCAAAAGATCTGTTGGATCTGGGTTAAAGTTCACTTCTACCTCTACCTTTTCTGGATCAACAGGACTAGGAGGGTCTTCCTCGTCCTCTAAGTCAGAATCTTCAACTTCTGAGTTCCCCAGCAGTACAGAGGGAGACATCGGTGAGGCAGATGAAGTTGAAGCTGGTTCATTGTCACATTCAAGCTCCACTACAGGCATAAGTGGAATGGTCTGAATGGCTTGGGAAAGCTGTGTTGGGCTGGAAGGGATTCCATTCTCCAGTAAGAACTCATCTAGGTCCATATACTCAAGGTGAAATGACTCTCCATCAAAGGGAAATGGTTTTGTCCCCAAATGGGGGGGCATGAATTGATGCAAAAGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAACAGTCCACACTGCGTTT