ORFeome > dhx33 ORF1 – XORFeome v1.0

dhx33 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dhx33
Gene ID: 6252181
Gene Page ID: 949472
ORF Xenbase ID: 17272539

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125981
Original XGC clone length: 801

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ838188
dbEST ID: 79655890
Trimmed Sequence: ATGATGAATAATATCAATCATCATGGCCACAAACAGCCTCCGGCTAAAAAGTTCAAGCCGAGTTCTCCTGCAGTCTACACCAAAAAGCAGGCGCCGATTCAATGTAGCGGCCCCAAGAAAATGACACTTGAGGAACAGCGCCGTAATCTGCCTATTTACCAGGCCCGCTCTCAGATCATTGCGCAGCTTCGGAAACTGGACAGTGTTGTGATCATAGGTGAGACAGGGTCAGGAAAGACAACTCAGATTCCACAGTACCTCTATGAAGCCAGCATAGGACGTCAGGGTGTCATTGCTGTGACTCAACCCCGTAGGGTGGCTGCCATATCACTTGCAACTAGGGTGTCACATGAAAGAAAAACAGAACTAAGTAAACTGGTAGGCTATACTGTGCGCTTTGAGGATGTCACATCAGAAGAGACAAAGATTAAATTCCTAACTGATGGGATGTTACTTCGTGAGGCAATTGGAGACCCACTTCTCCGCAAATACAGTGTAGTTATCCTGGATGAAGCTCATGAAAGGACAATTCACACTGATGTCCTGTTTTGGGGTTGTTAGATCCGCACAGAAGAAGCGGAAGGAGCAAGGAAAGCAGCCACTCAAGATTATTATAATGTCTGCCACAATGGATGTTGATCTGTTCTCAGAATACTTTCATGCAACCCCAGTTTAATACTTTGGAAGGAAGACGGCATCCCAGTCCAAATCTTCTATGCCCGAGAATCTCAAAACGATTACCTCCA
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGAATAATATCAATCATCATGGCCACAAACAGCCTCCGGCTAAAAAGTTCAAGCCGAGTTCTCCTGCAGTCTACACCAAAAAGCAGGCGCCGATTCAATGTAGCGGCCCCAAGAAAATGACACTTGAGGAACAGCGCCGTAATCTGCCTATTTACCAGGCCCGCTCTCAGATCATTGCGCAGCTTCGGAAACTGGACAGTGTTGTGATCATAGGTGAGACAGGGTCAGGAAAGACAACTCAGATTCCACAGTACCTCTATGAAGCCAGCATAGGACGTCAGGGTGTCATTGCTGTGACTCAACCCCGTAGGGTGGCTGCCATATCACTTGCAACTAGGGTGTCACATGAAAGAAAAACAGAACTAAGTAAACTGGTAGGCTATACTGTGCGCTTTGAGGATGTCACATCAGAAGAGACAAAGATTAAATTCCTAACTGATGGGATGTTACTTCGTGAGGCAATTGGAGACCCACTTCTCCGCAAATACAGTGTAGTTATCCTGGATGAAGCTCATGAAAGGACAATTCACACTGATGTCCTGTTTTGGGGTTGTTAGATCCGCACAGAAGAAGCGGAAGGAGCAAGGAAAGCAGCCACTCAAGATTATTATAATGTCTGCCACAATGGATGTTGATCTGTTCTCAGAATACTTTCATGCAACCCCAGTTTAATACTTTGGAAGGAAGACGGCATCCCAGTCCAAATCTTCTATGCCCGAGAATCTCAAAACGATTACCTCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGAATAATATCAATCATCAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838187
dbEST ID: 79655889
Trimmed Sequence: AAATGTCGTGAGAAGCAGGAACTGGTGGACCTGAAAGACTGTGACAAGGGCAGCTTGGAGGTAATCGCTTTGAGATTCTTCGGCATAGAAGATCTGAATGGGATGCTGTCTTCCTTCCAAGTATAAAACTGGGGCTGCATTGAAGTACTCTGAGAACAGATCAACATCCATTGTGGCAGACATTATAATAATCTTGAGTGGCTGCTTTCCTTGCTCCTTCCGCTTCTTCTGTGCGGATTTAACAACCCCAAACAGGACATCAGTGTGAATTGTCCTTTCATGAGCTTCATCCAGGATAACTACACTGTATTTGCGGAGAAGTGGGTCTCCAATTGCCTCACGAAGTAACATCCCATCAGTTAGGAATTTAATCTTTGTCTCTTCTGATGTGACATCCTCAAAGCGCACAGTATAGCCTACCAGTTTACTTAGTTCTGTTTTTCTTTCATGTGACACCCTAGTTGCAAGTGATATGGCAGCCACCCTACGGGGTTGAGTCACAGCAATGACACCCTGACGTCCTATGCTGGCTTCATAGAGGTACTGTGGAGTCTGAGTTGTCTTTCCTGACCCTGTCTCACCCATGATCACAACACTGTCCAGTTTCCGAAGCTCCGCAATGATCTTAAAACGGGGCCTGGTAAAATAGGCAAATAAGGGGCTGTTCCCTCAATGGTCATTTTTCTGGGGGCCCCCTACTTGGAATCCGCCGCCCTGCCTTTTTGGGTTGTAAACCTGGCGAGAAGAAACATCAAACCTTGAA
Full Trace Sequence: GCGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAATGTCGTGAGAAGCAGGAACTGGTGGACCTGAAAGACTGTGACAAGGGCAGCTTGGAGGTAATCGCTTTGAGATTCTTCGGCATAGAAGATCTGAATGGGATGCTGTCTTCCTTCCAAGTATAAAACTGGGGCTGCATTGAAGTACTCTGAGAACAGATCAACATCCATTGTGGCAGACATTATAATAATCTTGAGTGGCTGCTTTCCTTGCTCCTTCCGCTTCTTCTGTGCGGATTTAACAACCCCAAACAGGACATCAGTGTGAATTGTCCTTTCATGAGCTTCATCCAGGATAACTACACTGTATTTGCGGAGAAGTGGGTCTCCAATTGCCTCACGAAGTAACATCCCATCAGTTAGGAATTTAATCTTTGTCTCTTCTGATGTGACATCCTCAAAGCGCACAGTATAGCCTACCAGTTTACTTAGTTCTGTTTTTCTTTCATGTGACACCCTAGTTGCAAGTGATATGGCAGCCACCCTACGGGGTTGAGTCACAGCAATGACACCCTGACGTCCTATGCTGGCTTCATAGAGGTACTGTGGAGTCTGAGTTGTCTTTCCTGACCCTGTCTCACCCATGATCACAACACTGTCCAGTTTCCGAAGCTCCGCAATGATCTTAAAACGGGGCCTGGTAAAATAGGCAAATAAGGGGCTGTTCCCTCAATGGTCATTTTTCTGGGGGCCCCCTACTTGGAATCCGCCGCCCTGCCTTTTTGGGTTGTAAACCTGGCGAGAAGAAACATCAAACCTTGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAATGTCGTGAGAAGCAGGAA