ORFeome > dlx6 ORF1 – XORFeome v1.0

dlx6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dlx6
Gene ID: 6252964
Gene Page ID: 853183
ORF Xenbase ID: 17272659

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106204
Original XGC clone length: 762

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ837967
dbEST ID: 79655669
Trimmed Sequence: ATGATGACCATGACTACGATGGCTGACGGCTTGGAAGCTCAGGACTCCTCCAAGTCTGCCTTTATGGAGTTTGGTCAGCAGCAGTCCCACTCCCAGCAAAGCTCGCCGGTCATGGCAGCCGGTCACTACCCTAGTCTACACTGCCTGCACTCCGGCTCCCACCATCACCCGCAACACCAGCACGACACCAACTACTCCGGCAGCAACTCGTACAGCCGCTCCCTGGCCGCCTACCCTTACATGAGCCACTCTCAGCACAGCCCCTACCTGCAGTCCTGCAACAGCAACACCACGACTCAGAGCCGAGCCGAGGAACCAGACCAGCAAAAAACAACGGTGATAGAAAATGGGGAAATCCGGTTTAATGGGAAAGGGAAGAAAATTCGCAAGCCCAGGACGATATACTCCAGTCTCCAGCTGCAGGCTTTAAACCATCGCTTCCAGCAAACCCAGTACCTGGCACTACCAGAGAGGGCAGAGCTGGCTGCTTCTTTGGGTGTCACTCAGACTCAGGTGAAGATCTGGTTTCAGAACAAAAGGTCCAAGTACAAGAAGCTGATTAAACAAGGCAATAATCCCCTCGAAATCGATCAATTGGCCGGCACAGTCGCCCTCTCGCCACGGTCTCCAGCCATTCCTCCCGTGTGGGACGTTTCGGCCTCCTAAGGGTTAGTATGGCTTCCCACCGCTACATGCCTGGGCACTCCCACGTGGTACCCCTCCCCCCCCCCCAGAACCCAATGGCAAGGGTCGCAAATGAATTTTGCCCCACTTTTCTTTGTACAAAATTGGGGAATTAATAAAAAAAACCATTTTGC
Full Trace Sequence: TCGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGACCATGACTACGATGGCTGACGGCTTGGAAGCTCAGGACTCCTCCAAGTCTGCCTTTATGGAGTTTGGTCAGCAGCAGTCCCACTCCCAGCAAAGCTCGCCGGTCATGGCAGCCGGTCACTACCCTAGTCTACACTGCCTGCACTCCGGCTCCCACCATCACCCGCAACACCAGCACGACACCAACTACTCCGGCAGCAACTCGTACAGCCGCTCCCTGGCCGCCTACCCTTACATGAGCCACTCTCAGCACAGCCCCTACCTGCAGTCCTGCAACAGCAACACCACGACTCAGAGCCGAGCCGAGGAACCAGACCAGCAAAAAACAACGGTGATAGAAAATGGGGAAATCCGGTTTAATGGGAAAGGGAAGAAAATTCGCAAGCCCAGGACGATATACTCCAGTCTCCAGCTGCAGGCTTTAAACCATCGCTTCCAGCAAACCCAGTACCTGGCACTACCAGAGAGGGCAGAGCTGGCTGCTTCTTTGGGTGTCACTCAGACTCAGGTGAAGATCTGGTTTCAGAACAAAAGGTCCAAGTACAAGAAGCTGATTAAACAAGGCAATAATCCCCTCGAAATCGATCAATTGGCCGGCACAGTCGCCCTCTCGCCACGGTCTCCAGCCATTCCTCCCGTGTGGGACGTTTCGGCCTCCTAAGGGTTAGTATGGCTTCCCACCGCTACATGCCTGGGCACTCCCACGTGGTACCCCTCCCCCCCCCCCAGAACCCAATGGCAAGGGTCGCAAATGAATTTTGCCCCACTTTTCTTTGTACAAAATTGGGGAATTAATAAAAAAAACCATTTTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGACCATGACTACGATGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837966
dbEST ID: 79655668
Trimmed Sequence: CATCATTTGCGACCTTTGCATTGTGTCTTGGTGCGGGGACGAGTACCAGTGGGAGTAGCCAGGCATGTAGCTGTTGGGAGCCATACTAACCCCCTTAGAGGCCGAAACGTCCCACACGGGAGGAATGGCTGGAGACCGTGGCGAGAGGGCGACTGTGCCGGCCAATTGATCGATTTCGAGGGGATTATTGCCTTGTTTAATCAGCTTCTTGTACTTGGACCTTTTGTTCTGAAACCAGATCTTCACCTGAGTCTGAGTGACACCCAAAGAAGCAGCCAGCTCTGCCCTCTCTGGTAGTGCCAGGTACTGGGTTTGCTGGAAGCGATGGTTTAAAGCCTGCAGCTGGAGACTGGAGTATATCGTCCTGGGCTTGCGAATTTTCTTCCCTTTCCCATTAAACCGGATTTCCCCATTTTCTATCACCGTTGTTTTTTGCTGGTCTGGTTCCTCGGCTCGGCTCTGAGTCGTGGTGTTGCTGTTGCAGGACTGCAGGTAGGGGCTGTGCTGAAAGTGGCTCATGTAAGGGTAGGCGGCCCAGGAGCGCTGTACGAGTTGCTGCCGGAATAATTGGTGTTCTGCTGTTGTTTGGGGTGATGGTGGGAACCCGGATGCAGGGCGGTTAAACTAAGGTAATAAACGGCTGCCGTGGCCGGCCAACCTTGCCGGGGAGTGGGACTGGCGGGGGACCAAAGCCCGAAAAGATCAAGGTGTGAGAGGGAGGGCGAGACCTTCGGAAACAGGCCCCCCCAACGGAATTGCAAGGTGGCGGGGAAG
Full Trace Sequence: AAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATCATTTGCGACCTTTGCATTGTGTCTTGGTGCGGGGACGAGTACCAGTGGGAGTAGCCAGGCATGTAGCTGTTGGGAGCCATACTAACCCCCTTAGAGGCCGAAACGTCCCACACGGGAGGAATGGCTGGAGACCGTGGCGAGAGGGCGACTGTGCCGGCCAATTGATCGATTTCGAGGGGATTATTGCCTTGTTTAATCAGCTTCTTGTACTTGGACCTTTTGTTCTGAAACCAGATCTTCACCTGAGTCTGAGTGACACCCAAAGAAGCAGCCAGCTCTGCCCTCTCTGGTAGTGCCAGGTACTGGGTTTGCTGGAAGCGATGGTTTAAAGCCTGCAGCTGGAGACTGGAGTATATCGTCCTGGGCTTGCGAATTTTCTTCCCTTTCCCATTAAACCGGATTTCCCCATTTTCTATCACCGTTGTTTTTTGCTGGTCTGGTTCCTCGGCTCGGCTCTGAGTCGTGGTGTTGCTGTTGCAGGACTGCAGGTAGGGGCTGTGCTGAAAGTGGCTCATGTAAGGGTAGGCGGCCCAGGAGCGCTGTACGAGTTGCTGCCGGAATAATTGGTGTTCTGCTGTTGTTTGGGGTGATGGTGGGAACCCGGATGCAGGGCGGTTAAACTAAGGTAATAAACGGCTGCCGTGGCCGGCCAACCTTGCCGGGGAGTGGGACTGGCGGGGGACCAAAGCCCGAAAAGATCAAGGTGTGAGAGGGAGGGCGAGACCTTCGGAAACAGGCCCCCCCAACGGAATTGCAAGGTGGCGGGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATCATTTGCGACCTTTGCATT