ORFeome > dyrk1a.2 ORF1 – XORFeome v1.0

dyrk1a.2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: dyrk1a.2
Gene ID: 5760801
Gene Page ID: 5760737
ORF Xenbase ID: 17273415

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC044104
Original XGC clone length: 2016

Human orthology & disease relationships

NCBI Entrez ID: 1859
Ensembl gene IDs: ENSG00000157540
Directly associated (OMIM) disease MIM numbers: 614104
Indirectly associated (Lage, et al.) disease MIM numbers: 115150,125853,164400,191100,605407,606690

Library Location

Plate ID: GDExl11009
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ823756
dbEST ID: 79641458
Trimmed Sequence: ATGTCGAGCCAGCACAGCCACGCTCCTTTTTCCAGCCTTCAGTCAATGGCTGATCATCAACAGGGCCTGCCTGATATGACCATTTTACAAAGGCGGATTCCATTAACCTTTATAGAATCACCAGCTGCACCACTAAGGAAGCTTTCGGTGGATTTAATAAAAACTTACAAGCACATAAATGAGGTGTATTATACTAAAAAGAAGCGACAAACTCAGCAAGTGCCACCTGAAAACTCCAGCACGAAAAAGGAAAAAAAAGTATTCAATGATGGCTTTGATGATGACAACTATGACTATATTGTAAAAAATGGCGAAAAGTGAATGGACCGGTATGAAATACATTCCCTCATTGGAAAAGGATCCTTTGGACAAGTGGTAAAGGCATATGATCATCACAATCAAGAATGGGTAGCTATCAAAATTATCAAAAATAAAAAAGCCTTTCTGAACAAGGCTCAGATCGAGTTGCGGCTTCTTGACCTAATGAACAAACATGATACGGAAATGAAGTATTACATAGTGCACTTAAAACGGCACTTCATGTTTCGAAACCATCTTTGCCTGGTGTTTGAGCTACTGTCGTACAACTTATATGATCTTCTAAGACACACAAACTTCCGCGGCGTCTCCCTGAACCTCACCCGCAAGTTTGCGCAGCAGCTTTGTACTGCTTTGCTTTTCTTGACTACTCCTGAACTTAGTAATATCCATTGTGACCTGCAAACTGAACAATATCCTTTCTGTGTACCCCCAAATCCCAGTTGCCATCCAAAATTGTGGGACTTTTGGCAG
Full Trace Sequence: AGTAATGGATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGAGCCAGCACAGCCACGCTCCTTTTTCCAGCCTTCAGTCAATGGCTGATCATCAACAGGGCCTGCCTGATATGACCATTTTACAAAGGCGGATTCCATTAACCTTTATAGAATCACCAGCTGCACCACTAAGGAAGCTTTCGGTGGATTTAATAAAAACTTACAAGCACATAAATGAGGTGTATTATACTAAAAAGAAGCGACAAACTCAGCAAGTGCCACCTGAAAACTCCAGCACGAAAAAGGAAAAAAAAGTATTCAATGATGGCTTTGATGATGACAACTATGACTATATTGTAAAAAATGGCGAAAAGTGAATGGACCGGTATGAAATACATTCCCTCATTGGAAAAGGATCCTTTGGACAAGTGGTAAAGGCATATGATCATCACAATCAAGAATGGGTAGCTATCAAAATTATCAAAAATAAAAAAGCCTTTCTGAACAAGGCTCAGATCGAGTTGCGGCTTCTTGACCTAATGAACAAACATGATACGGAAATGAAGTATTACATAGTGCACTTAAAACGGCACTTCATGTTTCGAAACCATCTTTGCCTGGTGTTTGAGCTACTGTCGTACAACTTATATGATCTTCTAAGACACACAAACTTCCGCGGCGTCTCCCTGAACCTCACCCGCAAGTTTGCGCAGCAGCTTTGTACTGCTTTGCTTTTCTTGACTACTCCTGAACTTAGTAATATCCATTGTGACCTGCAAACTGAACAATATCCTTTCTGTGTACCCCCAAATCCCAGTTGCCATCCAAAATTGTGGGACTTTTGGCAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGAGCCAGCACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829065
dbEST ID: 79646767
Trimmed Sequence: AGAACTTGCTGCCGTACTCTGAGGAACACAAACGCCTAACATCGCACTCTCTTCCGTTTCCGTCCTGTTTCGGATGTGAGGGGGTCCAACCATGCTGGATGTGTTGCTAGTGTAGGGGTAATTCAGAGGCACGCCCGAATCCGTATGCCCACTGACTGTTCTAGTCCGAAAAGCAGATACTCCTAAGTGTAAGTTTGCGGAGCCAAAAGGAGTGCAGTCTAAGCTAGGGTGATGTGGGTGCAATGAAGAGGAAGACTGGGGGTGTCTGTGTCCCAAGCTGAGCTCCATAGACTCTGGGATTTGCGGAGAGGAGGAGGTGATGAGCTGCCGATGATAGTGCGGCCTGTTTACGTGATGATACAGCGGGTGAGGGTGATGCGGTTCGTTTCCATGAAAATGCTGCGGCTGACTGGGAGTTGGTTTGTGAGGTAAGATCTGAGGGTAGGAATCGCTGTTTGTGATTGGAACATCTCCACCAGCCCACAGTCTTATCTGCTGCTGTGAATGAGTCTGTGGACTCTGCATCTCATAATCTGTGTGGGCAACGGCACTGTTGTAGTATCTGTTGCTGTACCGGTAATTACGGTTATCATTCGAAGAAGCACTAGATCCTCCTGAGCTAGACACAGAACTGGTGGTACTTGTTGAGTGACTATGGGTCATTGCAGGGCTTGTAGAAGTACTATTACTTGTATTTGTCCCCTTCATCTGTTGTTTTCCTTGGAAGAAAGTGGTGCTGGGAAGGCCATAAGAAAGGGGGG
Full Trace Sequence: GGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAACTTGCTGCCGTACTCTGAGGAACACAAACGCCTAACATCGCACTCTCTTCCGTTTCCGTCCTGTTTCGGATGTGAGGGGGTCCAACCATGCTGGATGTGTTGCTAGTGTAGGGGTAATTCAGAGGCACGCCCGAATCCGTATGCCCACTGACTGTTCTAGTCCGAAAAGCAGATACTCCTAAGTGTAAGTTTGCGGAGCCAAAAGGAGTGCAGTCTAAGCTAGGGTGATGTGGGTGCAATGAAGAGGAAGACTGGGGGTGTCTGTGTCCCAAGCTGAGCTCCATAGACTCTGGGATTTGCGGAGAGGAGGAGGTGATGAGCTGCCGATGATAGTGCGGCCTGTTTACGTGATGATACAGCGGGTGAGGGTGATGCGGTTCGTTTCCATGAAAATGCTGCGGCTGACTGGGAGTTGGTTTGTGAGGTAAGATCTGAGGGTAGGAATCGCTGTTTGTGATTGGAACATCTCCACCAGCCCACAGTCTTATCTGCTGCTGTGAATGAGTCTGTGGACTCTGCATCTCATAATCTGTGTGGGCAACGGCACTGTTGTAGTATCTGTTGCTGTACCGGTAATTACGGTTATCATTCGAAGAAGCACTAGATCCTCCTGAGCTAGACACAGAACTGGTGGTACTTGTTGAGTGACTATGGGTCATTGCAGGGCTTGTAGAAGTACTATTACTTGTATTTGTCCCCTTCATCTGTTGTTTTCCTTGGAAGAAAGTGGTGCTGGGAAGGCCATAAGAAAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAACTTGCTGCCGTACTCTG