ORFeome > ergic3 ORF1 – XORFeome v1.0

ergic3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ergic3
Gene ID: 941882
Gene Page ID: 941876
ORF Xenbase ID: 17274621

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129572
Original XGC clone length: 1155

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ837902
dbEST ID: 79655604
Trimmed Sequence: ATGGAGGCGCTGCACCGGCTCAGGCAGTTTGATGCCTATCCCAAAACCTTGGAGGACTTTAGGGTTAAAACATGCGGAGGGGCAGTAGTTACAGTGATAAGCGGCCTTATCATGCTGATACTTTTCTTCTCAGAGCTCCAGTACTACCTCACGAAAGAAATCTACCCAGAACTATTTGTTGATAAGTCAAGAGGAGATAAGCTAAAGATCAACATTGATGTTATCTTCCCACACATGCCTTGTGCTTATTTAAGCATAGATGCGATGGATGTTGCTGGGGAGCAGCAGCTTGATGTGGAGCATAATCTGTTCAAACAGCGCCTGGATAAAGACAAAAAGCCCGTAACGTCGGAGGCAGACAAACATGAACTAGGTAAATTAGAAGAGCATGTAGTACTTGATCCAAAAACCTTAGACCCCAATCGTTGTGAAAGTTGCTACGGAGCTGAAACAGAGGACTTCAGTTGTTGCAACTCTTGTGATGATGTGCGGGAAGCTTACCGAAGGAAAGGCTGGGCATTTAAGACTCCAGATTCCATAGAACAGTGTAAAAGAGAGGGCTTTAGCCAGAAGATGCAGGAACAGAAGAACGAAGGATGCCAAATCTATGGGTTTCTTGAAGTGAAACAGGTTGCCGGGGAACTTTCACTTTGCTCCTGGGAAAAACTTCCCGCAATCTCATGGTCATGTACAGGATCTCCAAAAGCTTTGGGGCTTGACCAAAATAAATATAAAACATGAAAATCAAACATCTTCTCAATTTTGGAAAGGGAATTAATCCCTGGGTCTTTTGTCAAACCCCCTCCTGGA
Full Trace Sequence: TCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGCGCTGCACCGGCTCAGGCAGTTTGATGCCTATCCCAAAACCTTGGAGGACTTTAGGGTTAAAACATGCGGAGGGGCAGTAGTTACAGTGATAAGCGGCCTTATCATGCTGATACTTTTCTTCTCAGAGCTCCAGTACTACCTCACGAAAGAAATCTACCCAGAACTATTTGTTGATAAGTCAAGAGGAGATAAGCTAAAGATCAACATTGATGTTATCTTCCCACACATGCCTTGTGCTTATTTAAGCATAGATGCGATGGATGTTGCTGGGGAGCAGCAGCTTGATGTGGAGCATAATCTGTTCAAACAGCGCCTGGATAAAGACAAAAAGCCCGTAACGTCGGAGGCAGACAAACATGAACTAGGTAAATTAGAAGAGCATGTAGTACTTGATCCAAAAACCTTAGACCCCAATCGTTGTGAAAGTTGCTACGGAGCTGAAACAGAGGACTTCAGTTGTTGCAACTCTTGTGATGATGTGCGGGAAGCTTACCGAAGGAAAGGCTGGGCATTTAAGACTCCAGATTCCATAGAACAGTGTAAAAGAGAGGGCTTTAGCCAGAAGATGCAGGAACAGAAGAACGAAGGATGCCAAATCTATGGGTTTCTTGAAGTGAAACAGGTTGCCGGGGAACTTTCACTTTGCTCCTGGGAAAAACTTCCCGCAATCTCATGGTCATGTACAGGATCTCCAAAAGCTTTGGGGCTTGACCAAAATAAATATAAAACATGAAAATCAAACATCTTCTCAATTTTGGAAAGGGAATTAATCCCTGGGTCTTTTGTCAAACCCCCTCCTGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGCGCTGCACCG

Sequences - 3ʹ (reverse) EST

Accession: JZ837901
dbEST ID: 79655603
Trimmed Sequence: AGTGGCTTTTCCCAGCTCAATTTTCTTTTGGATGGCACGTGTGGAATGATAAATTAGGGCGTCAATGAGACTTGCAACTGTAAACACTCCTCCTATAATGGCACATACTCCCGTTAGAAAATGTGTAAACGACCTATGCTTCTCTGTGAGTTTTACCATCATTGGGGAGAGCTCATACAGGACAAAAACCCCAGGTAGACCCTGATCACCTATTAGTCCGTTGGTCATCTTTTCATGTCTGGTAACTGAAAACTGATTGGTCCGTAGAACCTCTCCATCGACTTTAACATAAACGGTCGGCACAATTTTCACAAAGTACTGGAACATCATCGATGATTGCATTGCTACTATGCTGGTCCCATCCAGAGGGTTGACAAGACCAGGATAATCCCTTCCAAATGAGAGATGTTTGATTTCATGTGTCATATTTATATTGTCAAGCCCAAAGCTCTGGAGATCATGTACATGGACATGAGATTGCTGGAAGCTTTTTCCAGGAGCAAAGTGAAAGTTCCCGGCAACCTTGTTCACTTCAAGAAACCCATAGATTTGGCATCCTTCGTTCTTCTGTTCCTGCATCTTCTGGCTAAAGCCCTCTCTTTTACACTGTTCTATGGAATCTGGAGTCTTAAATGCCCAGCCTTTCCTTCGGTAAGCTTCCCGCACATCATCACAAGAGTTGCAACAACTGAAGTCCTCTGTTTCAACTCCGTAACAACTTTCACAACGAATTGGGGTCTAAGGGTTTTTGATCAAGTACTACATGCTCTTCTAATTTACCTAATTCCTGTTGGTCTGCCTCCAACGTAACGGGCTTTTTGTCTTTAACCCGGCGCCTGTTTGGAAAGAATAAGCCTCCAAATCAGGGCTGCTGCTCCCCGGGCACATCCCTCGCAACTATGGCTTAAATAAACACAAGGGAATGTGTGGGGAAAAAAAGCGTCAATGTTGAATCCTTAAGCTTTATCCCCCCCTTGGACAAAACCCAAAAAAAAGAACCTGGGGGAAAAATTTTTTTCCGGGAGAGGGAAAAACGGTGGAGCGCTCGAAAAAAAAAAAAAGAATACAAAAAAAAAAAAAAAGGGCGCCCCCTTAATAACCCGGTGGAAACAAAACCCGCCCCCCCTCCTCCCACCAATTTTTTTATTAAACCCCCCTAAAAGAAGACCTCCCCCTCACGAAAGCGTTTTTTTTTTTGGGGAAAATTAAAAA
Full Trace Sequence: CGGGCAGGGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGTGGCTTTTCCCAGCTCAATTTTCTTTTGGATGGCACGTGTGGAATGATAAATTAGGGCGTCAATGAGACTTGCAACTGTAAACACTCCTCCTATAATGGCACATACTCCCGTTAGAAAATGTGTAAACGACCTATGCTTCTCTGTGAGTTTTACCATCATTGGGGAGAGCTCATACAGGACAAAAACCCCAGGTAGACCCTGATCACCTATTAGTCCGTTGGTCATCTTTTCATGTCTGGTAACTGAAAACTGATTGGTCCGTAGAACCTCTCCATCGACTTTAACATAAACGGTCGGCACAATTTTCACAAAGTACTGGAACATCATCGATGATTGCATTGCTACTATGCTGGTCCCATCCAGAGGGTTGACAAGACCAGGATAATCCCTTCCAAATGAGAGATGTTTGATTTCATGTGTCATATTTATATTGTCAAGCCCAAAGCTCTGGAGATCATGTACATGGACATGAGATTGCTGGAAGCTTTTTCCAGGAGCAAAGTGAAAGTTCCCGGCAACCTTGTTCACTTCAAGAAACCCATAGATTTGGCATCCTTCGTTCTTCTGTTCCTGCATCTTCTGGCTAAAGCCCTCTCTTTTACACTGTTCTATGGAATCTGGAGTCTTAAATGCCCAGCCTTTCCTTCGGTAAGCTTCCCGCACATCATCACAAGAGTTGCAACAACTGAAGTCCTCTGTTTCAACTCCGTAACAACTTTCACAACGAATTGGGGTCTAAGGGTTTTTGATCAAGTACTACATGCTCTTCTAATTTACCTAATTCCTGTTGGTCTGCCTCCAACGTAACGGGCTTTTTGTCTTTAACCCGGCGCCTGTTTGGAAAGAATAAGCCTCCAAATCAGGGCTGCTGCTCCCCGGGCACATCCCTCGCAACTATGGCTTAAATAAACACAAGGGAATGTGTGGGGAAAAAAAGCGTCAATGTTGAATCCTTAAGCTTTATCCCCCCCTTGGACAAAACCCAAAAAAAAGAACCTGGGGGAAAAATTTTTTTCCGGGAGAGGGAAAAACGGTGGAGCGCTCGAAAAAAAAAAAAAGAATACAAAAAAAAAAAAAAAGGGCGCCCCCTTAATAACCCGGTGGAAACAAAACCCGCCCCCCCTCCTCCCACCAATTTTTTTATTAAACCCCCCTAAAAGAAGACCTCCCCCTCACGAAAGCGTTTTTTTTTTTGGGGAAAATTAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTGGCTTTTCCCAGCTC