ORFeome > exd2 ORF1 – XORFeome v1.0

exd2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: exd2
Gene ID: 5752458
Gene Page ID: 5752407
ORF Xenbase ID: 17274801

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC059966
Original XGC clone length: 1536

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ824501
dbEST ID: 79642203
Trimmed Sequence: ATGGCTTCTTTCAGTGGATTTTGTGTCCTGGTTCGTTTGCCTCAACTGACAAGTTCAGGATGCACTATTCCAAAGACCCTACTTGAACTTTTGGCAAACAGCAGTGTTCTAAAGGTTGGAGTGGGATGCTGGGAAGACTCCTCTAAATTGTTGAATGATTATGGCCTTTCTGTGAAAGGATGTGTAGATATCCGATACCTGGCAATGAGACATAGGAGAGATATTCTCCAGAACACGCTGAGCCTGAAGTCTCTCTCAGAAACTATTTTATCATTTCCTTTGGACAAATCTTTTCAGCTTAGATGCAGTAACTGGGATGTTGAAGAGTTAACTCAGGATCAGGCAAAAGTCTCATCCATCCAGCCAGATATGCAGACCCGCAGTAGAACATGCTCAGAGTCACACTCCTTGTTTCAATATCCCAGTGCAAAGGTTTTGTATGCTGCCAGAGATGCTCAGGTATCTGTTGCCCTTTTCCTGCACCTTCTTGGGTTCTTCTCGGCTGATTTGCCCTGCCCATGGGAACCGTTGTTGGGAAAATGCCAAGGACTAATAGATATTCCCTTTAAAGGAAAAGGGAATGGTATTTCGAATGGTGAAGTGAGTGGATCCTTAAAACAGAGGACAGAGAAAGCTGGTGATCAGTCAACACAAAACTCTCAAGACAGCGAT
Full Trace Sequence: GGGCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTTTCAGTGGATTTTGTGTCCTGGTTCGTTTGCCTCAACTGACAAGTTCAGGATGCACTATTCCAAAGACCCTACTTGAACTTTTGGCAAACAGCAGTGTTCTAAAGGTTGGAGTGGGATGCTGGGAAGACTCCTCTAAATTGTTGAATGATTATGGCCTTTCTGTGAAAGGATGTGTAGATATCCGATACCTGGCAATGAGACATAGGAGAGATATTCTCCAGAACACGCTGAGCCTGAAGTCTCTCTCAGAAACTATTTTATCATTTCCTTTGGACAAATCTTTTCAGCTTAGATGCAGTAACTGGGATGTTGAAGAGTTAACTCAGGATCAGGCAAAAGTCTCATCCATCCAGCCAGATATGCAGACCCGCAGTAGAACATGCTCAGAGTCACACTCCTTGTTTCAATATCCCAGTGCAAAGGTTTTGTATGCTGCCAGAGATGCTCAGGTATCTGTTGCCCTTTTCCTGCACCTTCTTGGGTTCTTCTCGGCTGATTTGCCCTGCCCATGGGAACCGTTGTTGGGAAAATGCCAAGGACTAATAGATATTCCCTTTAAAGGAAAAGGGAATGGTATTTCGAATGGTGAAGTGAGTGGATCCTTAAAACAGAGGACAGAGAAAGCTGGTGATCAGTCAACACAAAACTCTCAAGACAGCGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTTTCAGTGGATTTTGT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GCGCCGGGGGAACCGGCTACGAACCAGGTAGTCCACCCACCATGGAGGGGAAAGCGCGCGGGAGGGAAAATAAGGATTTTTTTTTGCTGGAGAGGGCCCGGTTCGTGCCACCAAATTAAAAACCAAGGCTTCCTTATAAGGCCACCTTTCGCAAAAAAAGTGGGCAAGGAAGCAGCTCCTTGAGGACGGAGATAACCCCATCACCATGATGTGGAATGTACATGCTCCATTCGCACGGGATCGCATAGCATTACAAGTCGGCGATCGTCCTACGTTATCCTTGTACTCGATCGCTTCCACATGAAGCGGCCCTCGGAGCCACTGCAAAAGCCTTGCAAACACTTTGAAGCCCTCCTGCCTCCCATCGCGCGTGCTACCAGAAATTCGAGGCGCTCCCGCCCAAAGATAGACACCCCCGACGATTCTCTGTACATCGTGGAACAAGCCAGGAAACCACCCGCGGGACTAGTTCATCACTGTAGTCATCCATACTTGGACGGTCCAGGGTTATGTCATCGCTAGCCCTATCGCGAGCCGGACACCAGGGCAGAGCGTTGGAGAAGACGTACACCTCCAACTCCTGACTCAGTTCGCGAATCTACCTCTGCTTGAACACGCCACGGCTTCCATCCGCATCGCCGAAAAGCCAAAACATAGGCTGGCACGGCTCTGCACTCTCTGCACGCACAAGATATGACCATCAGTACGAGATCCGGCTCCAGCCGGCCGGGGACAACCGGAGTTATCCTGACACGAGGAAAAGACCCAGATAATACTAGCAGATTGAGAGGAACAGCATCCCGGGGATAAGAAGGAGGCACCCCTTGTCCCAAACAAAAAAAAAAAACCTCCCTTTGAATTTAAGGGAAACGGTGAAAACTTTCGTCCCCCACACACCCCACATTTTTAAAATTCTTTATCCCCAAAAAAAAACTTTGGACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGAGTTGGACAACAAGA