ORFeome > farsa ORF1 – XORFeome v1.0

farsa ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: farsa
Gene ID: 6253419
Gene Page ID: 946392
ORF Xenbase ID: 17275479

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054256
Original XGC clone length: 1500

Human orthology & disease relationships

NCBI Entrez ID: 2193
Ensembl gene IDs: ENSG00000179115
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 264070,606952,608323

Library Location

Plate ID: GDExl11003
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ839463
dbEST ID: 79657165
Trimmed Sequence: ATGGCAGATAACTTATTGTCGGAGCAGTTGTTACAGAGACTACAAGATGGAGATAACAAGGGAGTGGATACCCTGGAACTGGCGGCCGTGCTCAGTGTAGATCATCAGCAGGTAGTGGGGGCAGTGAAGAGCCTGCAGTGTCTGGGAGAGATAATTGAGGCAGAACAGCGCTCCAGCAAGAAATGGGAGCTCAGCTCGGAAGGGGAAGAGATTGCCCAAGTGGGAAGCCATGAGGCCCGGGTCTTCCAGAGCTTGCCCAAAGAAGGCTTGCTGCAAGCCGAACTAATGAAACTGCCGTTTGCAAAAGTTGGCTTCAGTAAAGCCATGTCCAACAAATGGATCCGACTGGATAAAGCAGCAGCAGGAGGGCCCTGCGTCTACAGAGTGGTAGAGACCATAGAGGATACGGTGAAGGAGAAGCTCCAGCTCATCCTCAAGGGAAGGGCCGATGATGTGAACGAGAAGGACAAGAACGAGCTGAAGAAAAGGAAACTTGTCAATGAAGTGACGGTTAAATCCTACTGGGTGACAAAGGGATCCGGCTTCAGCACAAGCATCACCAAGCAAGAGACTGATCTGACCCCAGAAATGATTGCCAGTGGATCATGGAGGGGAGAAGCAGTTCAAGGGGCTATACTTCATTGCTCTGGGTGTGATGCCAGAGTGCGGGCATCTGCACCCACTGCTGAAAGTGCGCACCCCAGTCCGACAGATCTTTTCTGGAATGGGATTCACAGAGATGCCCACCAATACTTCATAAAAAAGCTCTTTCTGGAATTTCCATGCTCTTTTTCCACCCTCAGCCACCCCCCGTGCCCCAA
Full Trace Sequence: GTGGGCCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGATAACTTATTGTCGGAGCAGTTGTTACAGAGACTACAAGATGGAGATAACAAGGGAGTGGATACCCTGGAACTGGCGGCCGTGCTCAGTGTAGATCATCAGCAGGTAGTGGGGGCAGTGAAGAGCCTGCAGTGTCTGGGAGAGATAATTGAGGCAGAACAGCGCTCCAGCAAGAAATGGGAGCTCAGCTCGGAAGGGGAAGAGATTGCCCAAGTGGGAAGCCATGAGGCCCGGGTCTTCCAGAGCTTGCCCAAAGAAGGCTTGCTGCAAGCCGAACTAATGAAACTGCCGTTTGCAAAAGTTGGCTTCAGTAAAGCCATGTCCAACAAATGGATCCGACTGGATAAAGCAGCAGCAGGAGGGCCCTGCGTCTACAGAGTGGTAGAGACCATAGAGGATACGGTGAAGGAGAAGCTCCAGCTCATCCTCAAGGGAAGGGCCGATGATGTGAACGAGAAGGACAAGAACGAGCTGAAGAAAAGGAAACTTGTCAATGAAGTGACGGTTAAATCCTACTGGGTGACAAAGGGATCCGGCTTCAGCACAAGCATCACCAAGCAAGAGACTGATCTGACCCCAGAAATGATTGCCAGTGGATCATGGAGGGGAGAAGCAGTTCAAGGGGCTATACTTCATTGCTCTGGGTGTGATGCCAGAGTGCGGGCATCTGCACCCACTGCTGAAAGTGCGCACCCCAGTCCGACAGATCTTTTCTGGAATGGGATTCACAGAGATGCCCACCAATACTTCATAAAAAAGCTCTTTCTGGAATTTCCATGCTCTTTTTCCACCCTCAGCCACCCCCCGTGCCCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGATAACTTATTGTCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839462
dbEST ID: 79657164
Trimmed Sequence: ACAAGCATCCAGGCGACAGATAGGGCTGTCGTAAACCATCTGCAAGTTGACTTTGTGTCCCACCAGCTCACGGATGTTTTTTATCCCGTATCTGATCATCGTTGGCCTTTCCAGCGACAGGCCCCAACCCAATACGTTGACGTCTCCCGGCAGACCCATCGGCAGCAGCAGCTCCGGCCTAAAAAGTCCAGAATTCCCAACTTCCACCCATTTCTTTAACCCTTCATGGTAACTGAACACTTCCATACTTGGCTCTGTGTAAGGGTTGTACGCTGGCTTGAAGCGCAGTTTAGTGATTCCCAGCTTGTGAAAGAATTCCTTTAGAACTCCCATGAGATTTCCCAGAGTTAAACCCCGATCTGCCACCACCCCCTCAATCTGGTGGAACTCAGCCAAGTGCGTTGCATCGAGCGTCTCGTTCCTGAACACCCGGTCAATGGAGAAATACTTCACAGGGGTGAACTCTTTCTGATGTGCCAGTTTGTACAGCATCCGAGCACTAACAGCTGTAGTGTGTGTCCTCAGAATGTTCTTTTGTGCCTCGTGGATACTCCAGTCATATTTGTACCCTTGGGAACCATATCCTCCTTCATAATGAACCTTCTTAACTCTTTCTAGATATTCATAGGAAACTCTATGGCTAAGGCTGGGATCCGGCAGAAAAAAAGTGTCGTGCTGATCCTCGGGCAGGGTGCTGCTGCCGGCTGGAAAAAAACCTCCAAAATTTCCAAAAAAACCTTTTCTAATAAAATTTTTTTGGGGGGGCAATTCCCCTTG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAAGCATCCAGGCGACAGATAGGGCTGTCGTAAACCATCTGCAAGTTGACTTTGTGTCCCACCAGCTCACGGATGTTTTTTATCCCGTATCTGATCATCGTTGGCCTTTCCAGCGACAGGCCCCAACCCAATACGTTGACGTCTCCCGGCAGACCCATCGGCAGCAGCAGCTCCGGCCTAAAAAGTCCAGAATTCCCAACTTCCACCCATTTCTTTAACCCTTCATGGTAACTGAACACTTCCATACTTGGCTCTGTGTAAGGGTTGTACGCTGGCTTGAAGCGCAGTTTAGTGATTCCCAGCTTGTGAAAGAATTCCTTTAGAACTCCCATGAGATTTCCCAGAGTTAAACCCCGATCTGCCACCACCCCCTCAATCTGGTGGAACTCAGCCAAGTGCGTTGCATCGAGCGTCTCGTTCCTGAACACCCGGTCAATGGAGAAATACTTCACAGGGGTGAACTCTTTCTGATGTGCCAGTTTGTACAGCATCCGAGCACTAACAGCTGTAGTGTGTGTCCTCAGAATGTTCTTTTGTGCCTCGTGGATACTCCAGTCATATTTGTACCCTTGGGAACCATATCCTCCTTCATAATGAACCTTCTTAACTCTTTCTAGATATTCATAGGAAACTCTATGGCTAAGGCTGGGATCCGGCAGAAAAAAAGTGTCGTGCTGATCCTCGGGCAGGGTGCTGCTGCCGGCTGGAAAAAAACCTCCAAAATTTCCAAAAAAACCTTTTCTAATAAAATTTTTTTGGGGGGGCAATTCCCCTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAAGCATCCAGGCGACA