ORFeome > fdx1 ORF1 – XORFeome v1.0

fdx1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fdx1
Gene ID: 990888
Gene Page ID: 990885
ORF Xenbase ID: 17275713

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130165
Original XGC clone length: 504

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ838493
dbEST ID: 79656195
Trimmed Sequence: ATGGCAGCCGCAGCAAAACTAGTGGGGCTCTCTCGCTGGTTGTTGGCCGGGTCCAGGCTCGGTGTCCCCGCTGCGCGCACACTCATGTGGAAGGGAAGCAGCCGCCTGGGGCCCGGGCACATTCGCTGGTTCAGCTCAGAAGATAAAGTGACAGTGAACTTTATAAATCGAGATGGAGATACACTGGTAGCAGAAGGAAAGGTCGGGGAATCGCTGCTGGATGTAGTTATAGAAAAAAACCTAAACATTGATGGCTTCGGTGCTTGTGAAGGAACACTCGCCTGCTCTACCTGCCACCTCATCTTTGAAGACCATATGTTTCACCAGCTGGAGCCAATCACTGATGAAGAGATGGATATGTTGGACCTCGCTTATGGACTGACTGATATGTCCCGGCTGGGCTGCCACATCTGCCTGAAGAAATCCATGAACGGAATGACCGTGAAAGTGCCCGAGTCTGTGGCCGACGTCCGGCAGGCGGTGGATATAGGGAAAAATTCATTGCCAACATTCTTGTACAAAGTGGGCTTATAAGAAAACAGTGCTCTATAATTTTGTTGTACCTAAAAAAACATTATTATTCAAAAAAAAATAATTATTTGCCACTCCGCTCAAATCACCAGATCTTATTATAAGTAAATGGTTAAAAGTCGTGTCGGGGGGAGACAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACGTCACCCGACCCCCAAAGCACCAGAGAAGAACGGAATTGGAAGTTTGGTTTGTGTGTGTTGTGGTGTTTGTTGTTGGATGGGGGTGATGGGAAAGAAAAGG
Full Trace Sequence: CTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTGGCACCATGGCAGCCGCAGCAAAACTAGTGGGGCTCTCTCGCTGGTTGTTGGCCGGGTCCAGGCTCGGTGTCCCCGCTGCGCGCACACTCATGTGGAAGGGAAGCAGCCGCCTGGGGCCCGGGCACATTCGCTGGTTCAGCTCAGAAGATAAAGTGACAGTGAACTTTATAAATCGAGATGGAGATACACTGGTAGCAGAAGGAAAGGTCGGGGAATCGCTGCTGGATGTAGTTATAGAAAAAAACCTAAACATTGATGGCTTCGGTGCTTGTGAAGGAACACTCGCCTGCTCTACCTGCCACCTCATCTTTGAAGACCATATGTTTCACCAGCTGGAGCCAATCACTGATGAAGAGATGGATATGTTGGACCTCGCTTATGGACTGACTGATATGTCCCGGCTGGGCTGCCACATCTGCCTGAAGAAATCCATGAACGGAATGACCGTGAAAGTGCCCGAGTCTGTGGCCGACGTCCGGCAGGCGGTGGATATAGGGAAAAATTCATTGCCAACATTCTTGTACAAAGTGGGCTTATAAGAAAACAGTGCTCTATAATTTTGTTGTACCTAAAAAAACATTATTATTCAAAAAAAAATAATTATTTGCCACTCCGCTCAAATCACCAGATCTTATTATAAGTAAATGGTTAAAAGTCGTGTCGGGGGGAGACAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACGTCACCCGACCCCCAAAGCACCAGAGAAGAACGGAATTGGAAGTTTGGTTTGTGTGTGTTGTGGTGTTTGTTGTTGGATGGGGGTGATGGGAAAGAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCCGCAGCAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838492
dbEST ID: 79656194
Trimmed Sequence: TGAACTTTTCCCCCTAACCCCCCGCCTGCCGGACGTCGGCCACAGACTCGGGCACTTTCACGGTCATTCCGTTCATGGATTTCTTCAGGCAGATCTGGCAGCCCAGCCGGGACATATCAGTCAGTCCATAAGCGAGGTCCAACATATCCATCTCTTCATCAGTGATTGGCTCCAGCTGCTGAAACATATGGTCTTCAAAGATGAGGTGGCAGGTAGAGCAGGCGAGTGTTCCTTCACAAGCACCGAAGCCATCAATGTCTAGGTTTTTTTCTATAACTACATCCAGCAGCGATTCCCCGACCTTTCCTTCTGCTACCAGTGTATCTCCATCTCGATTTATAAAGTTCACTGTCACTTTATCTTCTGAGCTGAACCAGCGAATGTGCCCGGGCCCCAGGCGGCTGCTTCCCTTCCACATGAGTGTGCGCGCAGCGGGGACACCGAGCCTGGACCCGGCCAACAACCAGCGAGAGAGCCCCACTACTTTTGCTGCGGCTGCCCTGGTGCGAGTTTTTTGTACAAATTTGGCATTATCAAAAAACAATGCTCATCAATTTTTTCCACGAAAAGAGGCCCAATCATTTCCAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAATAAAAAAAGAAACATACAATTACACCTCCTCCGACGCAGGGGAAAAGGAGAAANAAAACCCTCTTTCTTCCCCGTCTGTTCCTGTGTTGTGGTGGTTATAAGAAAAAAAAAAAAAAAAAAAAAAAACGCGAAAACAAAAGGGGGAATGGGTT
Full Trace Sequence: GGTAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAACTTTTCCCCCTAACCCCCCGCCTGCCGGACGTCGGCCACAGACTCGGGCACTTTCACGGTCATTCCGTTCATGGATTTCTTCAGGCAGATCTGGCAGCCCAGCCGGGACATATCAGTCAGTCCATAAGCGAGGTCCAACATATCCATCTCTTCATCAGTGATTGGCTCCAGCTGCTGAAACATATGGTCTTCAAAGATGAGGTGGCAGGTAGAGCAGGCGAGTGTTCCTTCACAAGCACCGAAGCCATCAATGTCTAGGTTTTTTTCTATAACTACATCCAGCAGCGATTCCCCGACCTTTCCTTCTGCTACCAGTGTATCTCCATCTCGATTTATAAAGTTCACTGTCACTTTATCTTCTGAGCTGAACCAGCGAATGTGCCCGGGCCCCAGGCGGCTGCTTCCCTTCCACATGAGTGTGCGCGCAGCGGGGACACCGAGCCTGGACCCGGCCAACAACCAGCGAGAGAGCCCCACTACTTTTGCTGCGGCTGCCCTGGTGCGAGTTTTTTGTACAAATTTGGCATTATCAAAAAACAATGCTCATCAATTTTTTCCACGAAAAGAGGCCCAATCATTTCCAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAATAAAAAAAGAAACATACAATTACACCTCCTCCGACGCAGGGGAAAAGGAGAAANAAAACCCTCTTTCTTCCCCGTCTGTTCCTGTGTTGTGGTGGTTATAAGAAAAAAAAAAAAAAAAAAAAAAAACGCGAAAACAAAAGGGGGAATGGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAACTTTTCCCCATATCCAC