ORFeome > fibp ORF1 – XORFeome v1.0

fibp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: fibp
Gene ID: 865450
Gene Page ID: 481174
ORF Xenbase ID: 17275887

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097711
Original XGC clone length: 1071

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: F08

Sequences - 5ʹ (forward) EST

Accession: JZ838401
dbEST ID: 79656103
Trimmed Sequence: ATGACTAATGAGCTAGATGTGTTTGTGGGTAACACCACACTAATAGATGAGGACGTCTATCAACTCTGGTTGGATGGATATTCAGTGAGTGATGCTGTTAACAATCGACTGAAAAGCGGCATTCTGGAGCAAACTGGTGCAGGAGCTGATGTCTTGGAAAGTGACACAATGGATCATTACCGTACATTCCAAATGATTGAGAGGCTTCTTCATTATCCTCCAAAACTTGTGCAACAGCTGCTTTTTCAGATACCCCCGTACAAACAAAGCATGTTAATTGAAAGATATTATGCATTTGATGAGGCCTTTGTCAGAGAAGTCCTTGGTAAGAAGCTCTCTAAAGGAACGAAGAAAGATCTTGATGACATCAGTTCAAAGACTGGAGTGACCCTAAAAAGCTGCAGGAGGCAGTTTGACAACTTCAAACGAGTGTTTAAAGTGGTAGAGGAGATGAGAGGCGCCCTGGTGGAGAATATCCAGCAGAATTTCCTGTTATCAGATAAACTTGCCAGGGATTATGCTGCTATAGTATTTTTTGCCAACAGTCGTTTTGAGACAGGGAAGAGAAAGCTCCAGTACTTGACATTTGAGGACTTTGCTACCTGTGCTGAACACCTCATTCAGAACTGGACACTTGGTGCAGTGGATGTAGCAGATGACATGGATATGGATTTAAATAAAGAGTTTCTCCAGGGATTTGAAAGATCTGAAAATTCTAATAAGGAACAAGAACCTCCTGGAATCCCCCTTAAGAGGTTTTGGTTTTGAACTTCTGT
Full Trace Sequence: CGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTAATGAGCTAGATGTGTTTGTGGGTAACACCACACTAATAGATGAGGACGTCTATCAACTCTGGTTGGATGGATATTCAGTGAGTGATGCTGTTAACAATCGACTGAAAAGCGGCATTCTGGAGCAAACTGGTGCAGGAGCTGATGTCTTGGAAAGTGACACAATGGATCATTACCGTACATTCCAAATGATTGAGAGGCTTCTTCATTATCCTCCAAAACTTGTGCAACAGCTGCTTTTTCAGATACCCCCGTACAAACAAAGCATGTTAATTGAAAGATATTATGCATTTGATGAGGCCTTTGTCAGAGAAGTCCTTGGTAAGAAGCTCTCTAAAGGAACGAAGAAAGATCTTGATGACATCAGTTCAAAGACTGGAGTGACCCTAAAAAGCTGCAGGAGGCAGTTTGACAACTTCAAACGAGTGTTTAAAGTGGTAGAGGAGATGAGAGGCGCCCTGGTGGAGAATATCCAGCAGAATTTCCTGTTATCAGATAAACTTGCCAGGGATTATGCTGCTATAGTATTTTTTGCCAACAGTCGTTTTGAGACAGGGAAGAGAAAGCTCCAGTACTTGACATTTGAGGACTTTGCTACCTGTGCTGAACACCTCATTCAGAACTGGACACTTGGTGCAGTGGATGTAGCAGATGACATGGATATGGATTTAAATAAAGAGTTTCTCCAGGGATTTGAAAGATCTGAAAATTCTAATAAGGAACAAGAACCTCCTGGAATCCCCCTTAAGAGGTTTTGGTTTTGAACTTCTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTAATGAGCTAGATGTGTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838400
dbEST ID: 79656102
Trimmed Sequence: GTTGTGATACATCTTCAGAAGACAGCTCCGGAGAGTACCCATGTATCTTTCCCAAAGAGCTTGCTGCTTGAAGGCATCAAGAGCACGAGCTGAGGCTGTGTACTGTGTTAGAAAGAGCTGGACATCTGAATAAGACCAACCAGCAGCTTTACAAGGCTCTATAAACTTTTCTACAAGGTCAATAAAAAAATCCCGCACATCTTTATTATGGGTTAGGCTGGTGCCAATGTTCACAAGCGCACGAGAGAGTGTCTTAAAATTCGAGTCCATTTCATGGAAGACACTCAATTTACCTCTCAATGATGTACACACCAAACTTTTATGCTGATCCACGAGGTCGGTGTCGGTTATTAAAATTTTCAGAGCTTTCAAATCCTCCAGAGACTCTTTAGCTAAATCCGTATCAGTGTCGGGTGCTACGTCCGCTGCACCGAATGTCGAGTTCTGATGGGAGGTGGGGGGCACAGTGAGGGAGTCCTCGTCTGTCAGGGTTCTGGAGCGGTCTCTTCCCTGTCGGCGGAGGAAAGGAGGGGGGGGGTAAAGTAACAACAGGAACTCTGGGGGGGGGGGTGGGGAGACGAGAAAATTGGGGATGGGGGTGGGGGAGCTCGCGCGGGCGGGGGGCCACGGCCCCCGCATTTAAAAAATGGAGAAAAAGTTCGTGGGATGGGGCCTCCAGGCAGGGGGGGGGATTTATGGGGGGGGGGGGATTTGGCGGGGTGA
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTGTGATACATCTTCAGAAGACAGCTCCGGAGAGTACCCATGTATCTTTCCCAAAGAGCTTGCTGCTTGAAGGCATCAAGAGCACGAGCTGAGGCTGTGTACTGTGTTAGAAAGAGCTGGACATCTGAATAAGACCAACCAGCAGCTTTACAAGGCTCTATAAACTTTTCTACAAGGTCAATAAAAAAATCCCGCACATCTTTATTATGGGTTAGGCTGGTGCCAATGTTCACAAGCGCACGAGAGAGTGTCTTAAAATTCGAGTCCATTTCATGGAAGACACTCAATTTACCTCTCAATGATGTACACACCAAACTTTTATGCTGATCCACGAGGTCGGTGTCGGTTATTAAAATTTTCAGAGCTTTCAAATCCTCCAGAGACTCTTTAGCTAAATCCGTATCAGTGTCGGGTGCTACGTCCGCTGCACCGAATGTCGAGTTCTGATGGGAGGTGGGGGGCACAGTGAGGGAGTCCTCGTCTGTCAGGGTTCTGGAGCGGTCTCTTCCCTGTCGGCGGAGGAAAGGAGGGGGGGGGTAAAGTAACAACAGGAACTCTGGGGGGGGGGGTGGGGAGACGAGAAAATTGGGGATGGGGGTGGGGGAGCTCGCGCGGGCGGGGGGCCACGGCCCCCGCATTTAAAAAATGGAGAAAAAGTTCGTGGGATGGGGCCTCCAGGCAGGGGGGGGGATTTATGGGGGGGGGGGGATTTGGCGGGGTGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGTGATACATCTTCAGAAGAC