ORFeome > g6pd ORF1 – XORFeome v1.0

g6pd ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: g6pd
Gene ID: 957690
Gene Page ID: 957683
ORF Xenbase ID: 17276523

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059324
Original XGC clone length: 1557

Human orthology & disease relationships

NCBI Entrez ID: 2539
Ensembl gene IDs: ENSG00000160211,LRG_148
Directly associated (OMIM) disease MIM numbers: 134700,300908,611162
Indirectly associated (Lage, et al.) disease MIM numbers: 125851,215600,223000,231900,235700,266130,602485,602579,604931,606003

Library Location

Plate ID: GDExl11019
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ824591
dbEST ID: 79642293
Trimmed Sequence: ATGAGTGAAGCCCACGAGCAAGTACACCTCAGTCGGTTGGAGGTGTGCGGAATGATGAGGGAAGAACTTTTAAGCGAACAAGAGTTCCACCAGTCTGAGACGCACATATTCATTGTCGTTGGAGCTTCGGGAGATCTGGCCAAAAAGAAGATCTACCCCACTCTGTGGTGGCTTTACAACGATGGTTTGCTCCCAGAAGACACCTACATAGTAGGCTTTGCACGTTCAAAGCTGACAGTGCAGGATATCAAAAAGCAGAGCGAGCCGTACTTCAAGGTATCTGCAGAGGATGCTTTGAAACTTGACACATTTTTCAAGCGCAACTCATATATTTCTGGACAATACTCAGATGCAGCCTCCTTCCAAAACCTTAACCAGCACCTGAATTCATTACCCAATGGGGCAAAAGCCAACCGCCTCTTCTACCTAGCACTACCACCCAGTGTGTATCATGATGTTACCCGCAACATCAAAGAGACCTGCATGAGCTCTGTAGGATGGAACCGTGTTATTGTGGAGAAACCTTTTGGCAAAGATCTGGAAAGTTCCAATCGTTTGTCGGAACACATCTCCTCCTTATACAAGGAAAACCAGATCTATCGTATCGACCATTACCTGGGCAAAGAGATGGTACAGAACCTCATGATCTTAAGATTTGGTAACAGGATATTCAGCCCCCTCTGGTCCAGGATCAATAANTGCCGTGGGTCTGACATTTAAAGAGCTTTTGAACACAGGGGGCGTGGAGGAAACTTTAACAAATTGGGTCCTCCCGGGAAGTCATGCAAATCCTGGCTCCCAATAGAGGGTTTGAGGGGCTTGGGAAAACCGGGCCCCCCCCCCCCAA
Full Trace Sequence: ATGTTTTCGAACTGGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGAAGCCCACGAGCAAGTACACCTCAGTCGGTTGGAGGTGTGCGGAATGATGAGGGAAGAACTTTTAAGCGAACAAGAGTTCCACCAGTCTGAGACGCACATATTCATTGTCGTTGGAGCTTCGGGAGATCTGGCCAAAAAGAAGATCTACCCCACTCTGTGGTGGCTTTACAACGATGGTTTGCTCCCAGAAGACACCTACATAGTAGGCTTTGCACGTTCAAAGCTGACAGTGCAGGATATCAAAAAGCAGAGCGAGCCGTACTTCAAGGTATCTGCAGAGGATGCTTTGAAACTTGACACATTTTTCAAGCGCAACTCATATATTTCTGGACAATACTCAGATGCAGCCTCCTTCCAAAACCTTAACCAGCACCTGAATTCATTACCCAATGGGGCAAAAGCCAACCGCCTCTTCTACCTAGCACTACCACCCAGTGTGTATCATGATGTTACCCGCAACATCAAAGAGACCTGCATGAGCTCTGTAGGATGGAACCGTGTTATTGTGGAGAAACCTTTTGGCAAAGATCTGGAAAGTTCCAATCGTTTGTCGGAACACATCTCCTCCTTATACAAGGAAAACCAGATCTATCGTATCGACCATTACCTGGGCAAAGAGATGGTACAGAACCTCATGATCTTAAGATTTGGTAACAGGATATTCAGCCCCCTCTGGTCCAGGATCAATAANTGCCGTGGGTCTGACATTTAAAGAGCTTTTGAACACAGGGGGCGTGGAGGAAACTTTAACAAATTGGGTCCTCCCGGGAAGTCATGCAAATCCTGGCTCCCAATAGAGGGTTTGAGGGGCTTGGGAAAACCGGGCCCCCCCCCCCCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGAAGCCCACGAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829942
dbEST ID: 79647644
Trimmed Sequence: GAGCTTGTTTGGGTTCACCCATTTGTAGGTTCCTGCATAATGGAAGCCAACCTTCTGCATTAGCTCGTCACTTTCTGCGGGCCCACGGCTTCCATATTTATAAGGATGGGGTTTGATTTTTTCTCTCTCCAGCTGATGGAGAACAGGGGTGAAGATCCTCCAAGCTTCTCTCAGTTCATCACTGCGTACAAAGTGCATCTGATTTCCACAGAACACATCCAAAATAAGCCGCTCATATGCGTCTGGCAACTTCACATCCTTGTATCTGCTGCCATATGTTAAGTCTAGCTCTGACTCCTCAGGGTTAAAGAACATTCCTGGCTTCTTGGTCATCATCTTGGTGTACACAGCTTCATTTGGCTGCACTCTGATCACCAGTTCATTCCTTTTGCATTGGCCTTGGAATATATCTCCAGGCACATCACGAAACTGCAGTCGTGCCTCTGCCTTCCTCTCGTTCAAGGCCTTGCCACAGCGCATGATAAAGGGGACACCATCCCAACGCTCATTCTGCACATATAGGACTGCAGTGGCAAATGTGGGGGTCAAAGATCCTTTTGGAACAGTGCGGTCATCCAAATAGCCTTCTTGTGCCTCGCCTTGTCCGTCCGGATTCCCAATATACTGCCCTATTACCAGATTATCANGATTGAGGGGAGCCACTGATTTCAACACTTTTCACCTTTTATCTCTAACATCCATCCGAAATTTGGTGGGAAAACCCGGCTTCTCCCTAACCCTTCCAAACCACTCACTTTTGGAAAACAAGTGGATT
Full Trace Sequence: AGTGGAAGCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGCTTGTTTGGGTTCACCCATTTGTAGGTTCCTGCATAATGGAAGCCAACCTTCTGCATTAGCTCGTCACTTTCTGCGGGCCCACGGCTTCCATATTTATAAGGATGGGGTTTGATTTTTTCTCTCTCCAGCTGATGGAGAACAGGGGTGAAGATCCTCCAAGCTTCTCTCAGTTCATCACTGCGTACAAAGTGCATCTGATTTCCACAGAACACATCCAAAATAAGCCGCTCATATGCGTCTGGCAACTTCACATCCTTGTATCTGCTGCCATATGTTAAGTCTAGCTCTGACTCCTCAGGGTTAAAGAACATTCCTGGCTTCTTGGTCATCATCTTGGTGTACACAGCTTCATTTGGCTGCACTCTGATCACCAGTTCATTCCTTTTGCATTGGCCTTGGAATATATCTCCAGGCACATCACGAAACTGCAGTCGTGCCTCTGCCTTCCTCTCGTTCAAGGCCTTGCCACAGCGCATGATAAAGGGGACACCATCCCAACGCTCATTCTGCACATATAGGACTGCAGTGGCAAATGTGGGGGTCAAAGATCCTTTTGGAACAGTGCGGTCATCCAAATAGCCTTCTTGTGCCTCGCCTTGTCCGTCCGGATTCCCAATATACTGCCCTATTACCAGATTATCANGATTGAGGGGAGCCACTGATTTCAACACTTTTCACCTTTTATCTCTAACATCCATCCGAAATTTGGTGGGAAAACCCGGCTTCTCCCTAACCCTTCCAAACCACTCACTTTTGGAAAACAAGTGGATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCTTGTTTGGGTTCACCCATT