ORFeome > gpnmb ORF1 – XORFeome v1.0

gpnmb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: gpnmb
Gene ID: 983267
Gene Page ID: 983262
ORF Xenbase ID: 17277783

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130049
Original XGC clone length: 1794

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ838511
dbEST ID: 79656213
Trimmed Sequence: ATGAAGTGTTTGGTGAGTGGGAGTGTGGTGCTGTTGCTCCTGCTGCAGGTTTCTGGATCCCAAGCAGTTAAACGATTTAAGGATGTGATGGTTCTTGGAAGGCAACCTGGCTACGGTAACTCTCATGAGCGACTGCATGGTTGGTCCCCTGGCAGCAATTCTTGGGATGAGAAACGGTACCCTTCCTGGAAAGCTGGAGATTCAAGATGGGAAAAATGCTGGAGAGGTGGGAAGGTGGTGGCACGTTTGACCAGTGACAGCCCAGCACTGATAGGGTCAAATGTTACATTTGCTGTGATGCTGCAGTTCCCTAGATGCCAGAAGGAAGATGTTAATGGGGATATTGTTTATGAAAGCCAGTGTCTAAATGGTTCCTCTAGTCTGCACGAACAATATGTTTATAACTGGACCCAGTGGAATGATTTCTGTAATGAGGGGAACTGCAGCTTTAACAGCAAGTTCCCAGATGGAAGTCCCTTTCCTTATCACAGTGACTGGAGAAGAAGGAACTTTATATACATTTTTCATACTTTACGCCAGTACTACCAACAAACTGGGGGGATCTTCAGCCTTGCTCTCACTAGATACAACAAACATTACTGCCCGCACACAGATGGGTTAAAGTGTCTTTCTACTGAAGAGGCCATAAACAACATTATCCAATTACCTTAACCAATTTTGCTCCACCTTTTTTTCTGAATATATCCCCCTTTTAGTTTAACATTTTCCCAAAAAAATGTACCCCAAATCCCTCGAAACGCGGAGGGTTTTATAAAAGATTTCTCCCATTTAATTTTTTTTCACTTCAAATAATTCTTTAAAATCACAAGCCCCCCAAA
Full Trace Sequence: CTGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGTGTTTGGTGAGTGGGAGTGTGGTGCTGTTGCTCCTGCTGCAGGTTTCTGGATCCCAAGCAGTTAAACGATTTAAGGATGTGATGGTTCTTGGAAGGCAACCTGGCTACGGTAACTCTCATGAGCGACTGCATGGTTGGTCCCCTGGCAGCAATTCTTGGGATGAGAAACGGTACCCTTCCTGGAAAGCTGGAGATTCAAGATGGGAAAAATGCTGGAGAGGTGGGAAGGTGGTGGCACGTTTGACCAGTGACAGCCCAGCACTGATAGGGTCAAATGTTACATTTGCTGTGATGCTGCAGTTCCCTAGATGCCAGAAGGAAGATGTTAATGGGGATATTGTTTATGAAAGCCAGTGTCTAAATGGTTCCTCTAGTCTGCACGAACAATATGTTTATAACTGGACCCAGTGGAATGATTTCTGTAATGAGGGGAACTGCAGCTTTAACAGCAAGTTCCCAGATGGAAGTCCCTTTCCTTATCACAGTGACTGGAGAAGAAGGAACTTTATATACATTTTTCATACTTTACGCCAGTACTACCAACAAACTGGGGGGATCTTCAGCCTTGCTCTCACTAGATACAACAAACATTACTGCCCGCACACAGATGGGTTAAAGTGTCTTTCTACTGAAGAGGCCATAAACAACATTATCCAATTACCTTAACCAATTTTGCTCCACCTTTTTTTCTGAATATATCCCCCTTTTAGTTTAACATTTTCCCAAAAAAATGTACCCCAAATCCCTCGAAACGCGGAGGGTTTTATAAAAGATTTCTCCCATTTAATTTTTTTTCACTTCAAATAATTCTTTAAAATCACAAGCCCCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGTGTTTGGTGAGTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838510
dbEST ID: 79656212
Trimmed Sequence: AATGATCCTTTGCTTTGTTTTCAGAAGTGGGTCCTGCTCATTGTTTCCTGGAAAGAGAACAGATTTGACTTGGCTGAAATATACACTAAGCCCACGATTATCACTGGTTGCTGCATTGTCAATGGGTCTGTATTCCTTGTATTTTTTGAGCAGAATGGCACCGACCACAGCTGCAACTATTACCACAAATCCCAGAGGAATCAAAACAGCCGCCACTGTCTTTTGCTTTGCAGAACCTCCACTTACAGACACCAGAGTACTTGCAAGAGCAAGGCTTGCATCATCACTTAGGGTAATGTTTACACAATAGGTTCCTGGTTGTGCAAAGGCACGCCTTACGGTTAAGGAGCACTGCTCATTGGCAGGGACCTCTTCACAAACCATGTTCTGTGGAATCATGCATGTGGAGTCAGAAATGAATGTACAAACATCCTTACGCTAGCTTCCTTGCCAGGTCGCAACAAAGTCAATCTAAGCATTTTCTTCTTGAGATGCAAGCGCCAGCACATTTGTCATTTCGATATAATTTATCTCTACATACCAATCAACAACTATTAAATTTATACGCTGAGAAAACAGATCGGTTGAATGAGACACACAACAACCACCGGCATATGCTTCTGCAGTCCAGGGACACCGGGCGCGGGCCTTGCATTTTTGGGGCGGCCCTTTACCCCTCCTTTTTGGGGGGGAAATTTTGGAGAAAGAAAAAGCGGGCGGGGGGCAGACAAAAGAAGGGAGGGATAATAAAAAATATCTTTTTTTTTTATTTTTATTACAAAAAAAAAA
Full Trace Sequence: GGTAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATGATCCTTTGCTTTGTTTTCAGAAGTGGGTCCTGCTCATTGTTTCCTGGAAAGAGAACAGATTTGACTTGGCTGAAATATACACTAAGCCCACGATTATCACTGGTTGCTGCATTGTCAATGGGTCTGTATTCCTTGTATTTTTTGAGCAGAATGGCACCGACCACAGCTGCAACTATTACCACAAATCCCAGAGGAATCAAAACAGCCGCCACTGTCTTTTGCTTTGCAGAACCTCCACTTACAGACACCAGAGTACTTGCAAGAGCAAGGCTTGCATCATCACTTAGGGTAATGTTTACACAATAGGTTCCTGGTTGTGCAAAGGCACGCCTTACGGTTAAGGAGCACTGCTCATTGGCAGGGACCTCTTCACAAACCATGTTCTGTGGAATCATGCATGTGGAGTCAGAAATGAATGTACAAACATCCTTACGCTAGCTTCCTTGCCAGGTCGCAACAAAGTCAATCTAAGCATTTTCTTCTTGAGATGCAAGCGCCAGCACATTTGTCATTTCGATATAATTTATCTCTACATACCAATCAACAACTATTAAATTTATACGCTGAGAAAACAGATCGGTTGAATGAGACACACAACAACCACCGGCATATGCTTCTGCAGTCCAGGGACACCGGGCGCGGGCCTTGCATTTTTGGGGCGGCCCTTTACCCCTCCTTTTTGGGGGGGAAATTTTGGAGAAAGAAAAAGCGGGCGGGGGGCAGACAAAAGAAGGGAGGGATAATAAAAAATATCTTTTTTTTTTATTTTTATTACAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATGATCCTTTGCTTTGTTTTCAG