ORFeome > hba2 ORF1 – XORFeome v1.0

hba2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hba2
Gene ID: 973892
Gene Page ID: 973888
ORF Xenbase ID: 17278611

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053818
Original XGC clone length: 429

Human orthology & disease relationships

NCBI Entrez ID: 3040
Ensembl gene IDs: ENSG00000188536,ENSG00000206172
Directly associated (OMIM) disease MIM numbers: 140700,604131,613978
Indirectly associated (Lage, et al.) disease MIM numbers: 603903

Library Location

Plate ID: GDExl11002
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ839323
dbEST ID: 79657025
Trimmed Sequence: ATGACTTTCTCTAGTGCTGAAAAGGCTGCTATTGCCTCCCTCTGGGGTAAGGTGTCTGGCCATACCGATGAAATTGGAGCTGAGGCTTTGGAGAGGTTGTTTTTGAGCTACCCTCAGACCAAGACCTACTTCAGCCATTTTGACCTGAGCCATGGCTCTAAGGATCTCCGTTCTCATGGAGGAAAAGTGGTGAAGGCCATTGGAAATGCTGCCACTCACATAGATGACATTCCCCATGCTCTGTCCGCTCTCAGTGACCTGCATGCCTTCAAACTAAAAGTTGATCCCGGAAACTTCAAACTGCTGTCCCATGCCATCCAAGTGACTCTGGCTATCCACTTCCCTGCTGAATTCAATGCTGATGCACAAGCTGCCTGGGACAAGTTCCTCGCCGTTGTCTCCGCTGTTCTGGTTTCCAAGTACAGATT
Full Trace Sequence: TCGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTTTCTCTAGTGCTGAAAAGGCTGCTATTGCCTCCCTCTGGGGTAAGGTGTCTGGCCATACCGATGAAATTGGAGCTGAGGCTTTGGAGAGGTTGTTTTTGAGCTACCCTCAGACCAAGACCTACTTCAGCCATTTTGACCTGAGCCATGGCTCTAAGGATCTCCGTTCTCATGGAGGAAAAGTGGTGAAGGCCATTGGAAATGCTGCCACTCACATAGATGACATTCCCCATGCTCTGTCCGCTCTCAGTGACCTGCATGCCTTCAAACTAAAAGTTGATCCCGGAAACTTCAAACTGCTGTCCCATGCCATCCAAGTGACTCTGGCTATCCACTTCCCTGCTGAATTCAATGCTGATGCACAAGCTGCCTGGGACAAGTTCCTCGCCGTTGTCTCCGCTGTTCTGGTTTCCAAGTACAGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGGCACAAAAAAAAGTATCTCAAATCTTATAATATTACATTTTTTGGGCGGCGGGTNNTNNTGGCGGCCGTCTTCCCCCCCCGCGCGTTCGCGAATAAAAAAAAAGGTGAAAGAAGAACAACACCACCACCCAAAACACCCCCCGGGGGCGTGTGGGAGTTGTATAAAGGGGCCCGGGTGGGGCCCCCCCCAACGGGGGCGAACACTCGAGCAAAACAACAACGCGGGGGGTGGAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTTCTCTAGTGCTGAAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839322
dbEST ID: 79657024
Trimmed Sequence: TCTGTACTTGGAAACCAGAACAGCGGAGACAACGGCGAGGAACTTGTCCCAGGCAGCTTGTGCATCAGCATTGAATTCAGCAGGGAAGTGGATAGCCAGAGTCACTTGGATGGCATGGGACAGCAGTTTGAAGTTTCCGGGATCAACTTTTAGTTTGAAGGCATGCAGGTCACTGAGAGCGGACAGAGCATGGGGAATGTCATCTATGTGAGTGGCAGCATTTCCAATGGCCTTCACCACTTTTCCTCCATGAGAACGGAGATCCTTAGAGCCATGGCTCAGGTCAAAATGGCTGAAGTAGGTCTTGGTCTGAGGGTAGCTCAAAAACAACCTCTCCAAAGCCTCAGCTCCAATTTCATCGGTATGGCCAGACACCTTACCCCAGAGGGAGGCAATATCAGCCTTTTCAGCACTAGAGAAAGTCATGG
Full Trace Sequence: GGGGCAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTGTACTTGGAAACCAGAACAGCGGAGACAACGGCGAGGAACTTGTCCCAGGCAGCTTGTGCATCAGCATTGAATTCAGCAGGGAAGTGGATAGCCAGAGTCACTTGGATGGCATGGGACAGCAGTTTGAAGTTTCCGGGATCAACTTTTAGTTTGAAGGCATGCAGGTCACTGAGAGCGGACAGAGCATGGGGAATGTCATCTATGTGAGTGGCAGCATTTCCAATGGCCTTCACCACTTTTCCTCCATGAGAACGGAGATCCTTAGAGCCATGGCTCAGGTCAAAATGGCTGAAGTAGGTCTTGGTCTGAGGGTAGCTCAAAAACAACCTCTCCAAAGCCTCAGCTCCAATTTCATCGGTATGGCCAGACACCTTACCCCAGAGGGAGGCAATATCAGCCTTTTCAGCACTAGAGAAAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCATTTTGTTGCAGCGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCGACCTTAAAACAGACCGTCGTTTACACTCCTTTTGACCTGGGGAAATACCCTGCCAGCTCTGACCCCGTTTCTCACCTCGCCTAAACTCTACCAGTGTGGAAGCAAACATAGGGAAAAAAAACACCGCAAAACACCAAAAACTACAACGGGGTGTGTTTATTTTGTGTTATAACAAAAACGAGGGGGGGCCCCACGCCCGCGGTGGCCAACTTTCNTTTTTTTTTTTGTGTGGGTGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTGTACTTGGAAACCAGAAC