ORFeome > hbg2 ORF1 – XORFeome v1.0

hbg2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: hbg2
Gene ID: 5808117
Gene Page ID: 5808004
ORF Xenbase ID: 17278653

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078566
Original XGC clone length: 444

Human orthology & disease relationships

NCBI Entrez ID: 3048
Ensembl gene IDs: ENSG00000196565
Directly associated (OMIM) disease MIM numbers: 141749,613977
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ839622
dbEST ID: 79657324
Trimmed Sequence: ATGGTCCATTGGACAGCTGAAGAGAAGGCCGCCATCACTTCTGTATGGCAGAAGGTCAATGTAGAACATGATGGCCATGATGCCCTGGGCAGGCTGCTGATTGTGTACCCCTGGACCCAGAGATACTTCAGTAACTTTGGAAACCTCTCCAATTCAGCTGCTGTTGCTGGAAATGCCAAGGTTCAAGCCCATGGCAAGAAGGTTCTTTCAGCTGTTGGCAATGCCATTAGCCATATTGACAGTGTGAAGTCCTCTCTCCAACAACTCAGTAAGATCCATGCCACTGAACTGTTTGTGGACCCTGAGAACTTTAAGCGTTTTGGTGGAGTTCTGGTCATTGTCTTGGGTGCCAAACTGGGAACTGCCTTCACTCCTAAAGTTCAGGCTGCTTGGGAGAAATTCATTGCAGTTTTGGTTGATGGTCTTAGCCAGGGCTATAACTT
Full Trace Sequence: TCGGGGGCCACATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTCCATTGGACAGCTGAAGAGAAGGCCGCCATCACTTCTGTATGGCAGAAGGTCAATGTAGAACATGATGGCCATGATGCCCTGGGCAGGCTGCTGATTGTGTACCCCTGGACCCAGAGATACTTCAGTAACTTTGGAAACCTCTCCAATTCAGCTGCTGTTGCTGGAAATGCCAAGGTTCAAGCCCATGGCAAGAAGGTTCTTTCAGCTGTTGGCAATGCCATTAGCCATATTGACAGTGTGAAGTCCTCTCTCCAACAACTCAGTAAGATCCATGCCACTGAACTGTTTGTGGACCCTGAGAACTTTAAGCGTTTTGGTGGAGTTCTGGTCATTGTCTTGGGTGCCAAACTGGGAACTGCCTTCACTCCTAAAGTTCAGGCTGCTTGGGAGAAATTCATTGCAGTTTTGGTTGATGGTCTTAGCCAGGGCTATAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCCATAGCTGTTTCAAAAAAACTCTGGCACGTGTCTCAAATCCCGTCAATTTACAGCCNCNGGGGGGGGGTGGCCCTCTTTGCCCCGCCCCTTTTTTTCGTTTGTCCCCCGGGGGNCGGCTCCAAAAAAAAAAAAAAAAAAAAAAAGTATAATTTTTAAAATATACCCCATCGGGGGGGCCCCCCCGCGGGTGAAAACATATCCCCTCCCCCGCGGGGTTTAGGCGCCGGTGGGGTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTCCATTGGACAGCTGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839621
dbEST ID: 79657323
Trimmed Sequence: GTTATAGCCCTGGCTAAGACCATCAACCAAAACTGCAATGAATTTCTCCCAAGCAGCCTGAACTTTAGGAGTGAAGGCAGTTCCCAGTTTGGCACCCAAGACAATGACCAGAACTCCACCAAAACGCTTAAAGTTCTCAGGGTCCACAAACAGTTCAGTGGCATGGATCTTACTGAGTTGTTGGAGAGAGGACTTCACACTGTCAATATGGCTAATGGCATTGCCAACAGCTGAAAGAACCTTCTTGCCATGGGCTTGAACCTTGGCATTTCCAGCAACAGCAGCTGAATTGGAGAGGTTTCCAAAGTTACTGAAGTATCTCTGGGTCCAGGGGTACACAATCAGCAGCCTGCCCAGGGCATCATGGCCATCATGTTCTACATTGACCTTCTGCCATACAGAAGTGATGGCGGCCTTCTCTTCAGCTGTCCAATGGACCATGG
Full Trace Sequence: GGGAATACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTATAGCCCTGGCTAAGACCATCAACCAAAACTGCAATGAATTTCTCCCAAGCAGCCTGAACTTTAGGAGTGAAGGCAGTTCCCAGTTTGGCACCCAAGACAATGACCAGAACTCCACCAAAACGCTTAAAGTTCTCAGGGTCCACAAACAGTTCAGTGGCATGGATCTTACTGAGTTGTTGGAGAGAGGACTTCACACTGTCAATATGGCTAATGGCATTGCCAACAGCTGAAAGAACCTTCTTGCCATGGGCTTGAACCTTGGCATTTCCAGCAACAGCAGCTGAATTGGAGAGGTTTCCAAAGTTACTGAAGTATCTCTGGGTCCAGGGGTACACAATCAGCAGCCTGCCCAGGGCATCATGGCCATCATGTTCTACATTGACCTTCTGCCATACAGAAGTGATGGCGGCCTTCTCTTCAGCTGTCCAATGGACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTTGGGGCCCGAGCAAAAAAAAAAAACGTCATTTTACACTCAAAAAACGGGAGCGAAAGCACCAAAAAAAAAAAGGTCCCCTCTTAGCTCCGCCCCTCTTCTGTGGGGGGGGCTCCGGGGAGAAAAAAATAACAGGAGGAACACAAACAGGGGAAGACACGTGTGGTGTTTAGATGAGAAAAGGGGGGGGGGAGGGGGCCCCCACNGGGGCGGGCGCGCAAAAAGATGGACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTATAGCCCTGGCTAAGA