ORFeome > hk2 ORF1 – XORFeome v1.0

hk2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hk2
Gene ID: 5817417
Gene Page ID: 5817380
ORF Xenbase ID: 17279055

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC129526
Original XGC clone length: 2742

Human orthology & disease relationships

NCBI Entrez ID: 3099
Ensembl gene IDs: ENSG00000159399
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 125851,125853,223000,230600,230650,235700,600858,602485,602579,604931,606003,606777

Library Location

Plate ID: GDExl11086
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAGCCCCAAGGTGTGATGTAACCTTTCTTCACTCCGATGATGATTCAAGGAGATTGGGCCGCGCCGAGCACCCCTTCGCCTCGCCCGATTGCTGCACCTAACGCTCATGCACCTTTTCCTACTTTACTGGAAGAGGTTCGCCTTAGAATTACAGCATTGCTTATGCCTTAGTTGCAACGAACAGGTCCCTACCAGTCTAACTACTTTCATTATTTGCCTTCCCACTAAAATACCGCATTGCGTATCAAATTATTGCAACGAACAGGTCACTCTGCAGTCTCACTACCCTCGTCTCTAAAACTCCGGCGTTTCAACACCTGTCGCGAAACTTCTTTCTTCGTCGGTGCGGTTTCCTCGCTTCTCTTGCCCGCGTCTCAAAGTCCCCCTTGTTCCATGGTTGAAAATTTGCCCGCGCGCGCGGCGTTCCTGTTGCGCTGCCCCGTTTCCTTCTGTCTTGCGNTTTGNTCGGTTTCTGCCCTCTCCTCTGTGGCCCGGTTTCTCCTCCCCTCGGGGTGTGTCGGTTCTGTCGNCGCCGGTCTCTGTTGTTTCCGTTGTGGCCGTCTCGTCGGCTTGTGCTCCTGTGNGGTTTGGCTGCTGGGTGTTGGTGNGTGCTCCTGCCTGCTCGCCGCGTTTGGCCGGCGCGGGGTGGTGNGTGTGGGNTCTGCCTGGCCTGTGTCGGCNGTTGTCTTTTTCCCGCGTTGTGTGCTGGCCCCTTTCCTCTGGCCGGTGCGCCTGCTCTCTTCTCCCGTCCCTGTGTTCCGTTGTCTTTTGTGNTTTCTTGNGGTCTGTTCTTGTTCTCTCCCTGCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAGCCCCAAGGGA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGCCAGGGGAAACNGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCTGCACGTGCCTCAGCTCCAGCAATCCGACAAGCCACCGCTGTAATCAGTGCAGCCCCTCTCCCTGAACCATCATCCCACTGAACAAATGTCACATAACACCTTGTGGCTCACCATGGTGCCCACTTTTTTGTACAAAGTTGGCATTATAAAAAACCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCCACCTTAATACAGCACGTCGTTTCACAACGAAATGACTGAACAAGATNCTGCCGTGAAAATANNATCTTTGTTTNNCGCCCAAAATGGANNCTNNNNNNNNGGNTAAAAANNNNNNNNNNGNGNGNNGNNAAAAAAANNNNNNNNNNNNNNNNGNNNNNNNNGNNNNNNNNNNNNGNNNNGNNNNNNNGNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNGNNNNNNNGNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNGGNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNGNNNNNGNNNGNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNGNNNNNNNGNNNNNNNNNGNNNNNNNNNNNGNNGNNNNNNNNNGNNGNNNNNGNNNNGNNNNNNNNNGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNGNGGGNNNNNNNNNNGGNNNNNNNNNNNNNNNGGNNNNNNNNNNNNNNNNNGGNNNNNNNNNNNGGNNNGGNGNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNGNNNNNNNNNNNNNNGNNNNNNNNNNNGNNNNGGNNNNNNNNGGGNNNNNNNNGGNNNNNNNNNNNNNNNNNNNNNNGNG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCTGCACGTGCCTCAGCTC