ORFeome > hmgb3 ORF1 – XORFeome v1.0

hmgb3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hmgb3
Gene ID: 1002020
Gene Page ID: 1002013
ORF Xenbase ID: 17279157

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123147
Original XGC clone length: 606

Human orthology & disease relationships

NCBI Entrez ID: 3149
Ensembl gene IDs: ENSG00000029993
Directly associated (OMIM) disease MIM numbers: 300915
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ838194
dbEST ID: 79655896
Trimmed Sequence: ATGGCTAAACGTGACCCTAAGAAGCCGAAAGGCAAGATGTCTGCTTACGCATATTTTGTGCAGACATGCCGCGAAGAACACAAAAAGAAAAATCCTGAAATCCCTGTCAACTTTGCAGAGTTTTCCAAGAAATGTTCTGAGAGATGGAGGTCCATGTCGGGTAAAGAGAAGTCAAAGTTTGAAGACCTGGCGAAGGCAGACAAAGTGCGGTATGACAGAGAAATGAAAGATTTTGGACCTGTAAAGAAAGGCAAGAGGAATAAAGACCCAAATGCCCCTAAAAGGCCACCATCTGGCTTTTTCCTTTTCTGCTCAGAATTCCGTCCAAAAATAAAATCTACAAACCCTGGTATTTCCATTGGTGATATTGCAAAGAAACTGGGTGAAATGTGGAATAACCTAAGTGATGGTGAGAAGCAGCCATACAACAATAAGGCAGCTAAACTTAAGGAAAAGTATGAAAAGGATGTTGCTGACTACAAATCTAAAGGAAAGTTTGATGGTGCTAAAGGAGCCCCAAAATTAGCACGGAAAAAAGAGGAAGATTATGACGACGACGAAGAAGAGGAGGAGGATGAAGAGGACGAAGAAAAAGATGATGAATT
Full Trace Sequence: GGAGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTAAACGTGACCCTAAGAAGCCGAAAGGCAAGATGTCTGCTTACGCATATTTTGTGCAGACATGCCGCGAAGAACACAAAAAGAAAAATCCTGAAATCCCTGTCAACTTTGCAGAGTTTTCCAAGAAATGTTCTGAGAGATGGAGGTCCATGTCGGGTAAAGAGAAGTCAAAGTTTGAAGACCTGGCGAAGGCAGACAAAGTGCGGTATGACAGAGAAATGAAAGATTTTGGACCTGTAAAGAAAGGCAAGAGGAATAAAGACCCAAATGCCCCTAAAAGGCCACCATCTGGCTTTTTCCTTTTCTGCTCAGAATTCCGTCCAAAAATAAAATCTACAAACCCTGGTATTTCCATTGGTGATATTGCAAAGAAACTGGGTGAAATGTGGAATAACCTAAGTGATGGTGAGAAGCAGCCATACAACAATAAGGCAGCTAAACTTAAGGAAAAGTATGAAAAGGATGTTGCTGACTACAAATCTAAAGGAAAGTTTGATGGTGCTAAAGGAGCCCCAAAATTAGCACGGAAAAAAGAGGAAGATTATGACGACGACGAAGAAGAGGAGGAGGATGAAGAGGACGAAGAAAAAGATGATGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCATTTTGTTGCAACGAACAGGTCACTATCAAGTCAAAATAAAATCATTATTTTGCCATCCCAGCTAAAAATCCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAATGATTTCCCCGTCCCCCCCCTGGGACGGGGGAGCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTAAACGTGACCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838193
dbEST ID: 79655895
Trimmed Sequence: TTCATCATCTTCTTCTTCGTCCTCTTCATCCTCCTCCTCTTCTTCGTCGTCGTCATAATCTTCCTCTTTTTTCCGTGCTAATTTTGGGGCTCCTTTAGCACCATCAAACTTTCCTTTAGATTTGTAGTCAGCAACATCCTTTTCATACTTTTCCTTAAGTTTAGCTGCCTTATTGTTGTATGGCTGCTTCTCACCATCACTTAGGTTATTCCACATTTCACCCAGTTTCTTTGCAATATCACCAATGGAAATACCAGGGTTTGTAGATTTTATTTTTGGACGGAATTCTGAGCAGAAAAGGAAAAAGCCAGATGGTGGCCTTTTAGGGGCATTTGGGTCTTTATTCCTCTTGCCTTTCTTTACAGGTCCAAAATCTTTCATTTCTCTGTCATACCGCACTTTGTCTGCCTTCGCCAGGTCTTCAAACTTTGACTTCTCTTTACCCGACATGGACCTCCATCTCTCAGAACATTTCTTGGAAAACTCTGCAGAGTTGACAGGGATTTCAGGATTTTTCTTTTTGTGTTCTTCGCGGCATGTCGGCACAAAATATGCGTAAGCAGACAACTTGCCTTTTCGCTTCTTAGGGTCAGGTGAAGCCCTGGTGGCCACTTTTTTGTACAAAAGTTGGCATTAATAAAAAACAATTGCTTCATCAATTTTGTTGTCACCGTACAAAGAAAAAATAACAAATGAAAAAAAAAAAAAATTAATTTTTCCGCCCAAAGCTTGGAGAAGAGGGGCGGGTCCTTTTTAAAACAACCCGCTTTTGCCC
Full Trace Sequence: GAGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATCATCTTCTTCTTCGTCCTCTTCATCCTCCTCCTCTTCTTCGTCGTCGTCATAATCTTCCTCTTTTTTCCGTGCTAATTTTGGGGCTCCTTTAGCACCATCAAACTTTCCTTTAGATTTGTAGTCAGCAACATCCTTTTCATACTTTTCCTTAAGTTTAGCTGCCTTATTGTTGTATGGCTGCTTCTCACCATCACTTAGGTTATTCCACATTTCACCCAGTTTCTTTGCAATATCACCAATGGAAATACCAGGGTTTGTAGATTTTATTTTTGGACGGAATTCTGAGCAGAAAAGGAAAAAGCCAGATGGTGGCCTTTTAGGGGCATTTGGGTCTTTATTCCTCTTGCCTTTCTTTACAGGTCCAAAATCTTTCATTTCTCTGTCATACCGCACTTTGTCTGCCTTCGCCAGGTCTTCAAACTTTGACTTCTCTTTACCCGACATGGACCTCCATCTCTCAGAACATTTCTTGGAAAACTCTGCAGAGTTGACAGGGATTTCAGGATTTTTCTTTTTGTGTTCTTCGCGGCATGTCGGCACAAAATATGCGTAAGCAGACAACTTGCCTTTTCGCTTCTTAGGGTCAGGTGAAGCCCTGGTGGCCACTTTTTTGTACAAAAGTTGGCATTAATAAAAAACAATTGCTTCATCAATTTTGTTGTCACCGTACAAAGAAAAAATAACAAATGAAAAAAAAAAAAAATTAATTTTTCCGCCCAAAGCTTGGAGAAGAGGGGCGGGTCCTTTTTAAAACAACCCGCTTTTGCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATCATCTTCTTCTTCGTCCT