ORFeome > hsbp1 ORF2 – XORFeome v1.0

hsbp1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: hsbp1
Gene ID: 952443
Gene Page ID: 952435
ORF Xenbase ID: 17279625

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133779
Original XGC clone length: 228

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ838465
dbEST ID: 79656167
Trimmed Sequence: ATGTCGGAGACAGACCCCAAGACTGTGCAGGACCTGACCGTGGTGGTGCAAAATTTGCTTCAGCAAATGCAAGACAAGTTCCAGACCATGTCAGACCAGATTATTGGGAGAATTGATGACATGAGCACTCGTATAGATGATCTGGAGAAGAATATCGCAGACCTCATGACACAGGCAGGAGTGGAAGAAGAGGAGAGTGCAAACAAGCAGCAGCCGCCCAAAATT
Full Trace Sequence: GGAGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGGAGACAGACCCCAAGACTGTGCAGGACCTGACCGTGGTGGTGCAAAATTTGCTTCAGCAAATGCAAGACAAGTTCCAGACCATGTCAGACCAGATTATTGGGAGAATTGATGACATGAGCACTCGTATAGATGATCTGGAGAAGAATATCGCAGACCTCATGACACAGGCAGGAGTGGAAGAAGAGGAGAGTGCAAACAAGCAGCAGCCGCCCAAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCTTATTACATGGTCATACCTGTTTCCTGGCACCTCTGGCCNAAATAAAAAAAAAAAAAAATATAGTATACTGGCTCCTAAGGAACCGCCCGGGAGGAAATGAATCGACTTCTCTGCTCCCCAAAGTGGGCGGGTGGTGGGTTTCGTGGGTTGGGGGGGAGGGAGGGAAACACGCGGGAGAAAAACCGTGGGGGGGTGGGGTGAGGGGAGGAAAAACCCAGGGGCCCCACCCCCCCCTGGGCCCAAAAAATTGAACGAAAAGAAACGGGTGGGAAAGGGCCCCCCGGGGGGTTTGTCCCCAAAATTTTTGGAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGAGACAGACCCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838464
dbEST ID: 79656166
Trimmed Sequence: TTTTGGGCGGCTGCTGCTTGTTTGCACTCTCCTCTTCTTCCACTCCTGCCTGTGTCATGAGGTCTGCGATATTCTTCTCCAGATCATCTATACAAGTGCTCATGTCATCAATTCTCCCAATAATCTGGTCTGACATGGTCTGGAACTTGTCTTGCATTTGCTGAAGCAAATTTTGCACCACCACGGTCAGGTCCTGCACAGTCTTGGGGTCTGTCTCCGACATGG
Full Trace Sequence: CGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTGGGCGGCTGCTGCTTGTTTGCACTCTCCTCTTCTTCCACTCCTGCCTGTGTCATGAGGTCTGCGATATTCTTCTCCAGATCATCTATACAAGTGCTCATGTCATCAATTCTCCCAATAATCTGGTCTGACATGGTCTGGAACTTGTCTTGCATTTGCTGAAGCAAATTTTGCACCACCACGGTCAGGTCCTGCACAGTCTTGGGGTCTGTCTCCGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGACCTTAATACTGCAAAAAAAAAAGAAAAGATAATGAATATGGTCCTAAAAGACAGACAGGACGAAAATGATACGATAAGGCTGCACCTAGAGGGGGCGGGTGGGTTATTCGTGGTAAGGGGGGAGGGGCCGAACCCAGTGGACCAATTCCTGTTGGGCGGTTAGTTTGGATGGAAAACACCTACGCCGAGCACCACCTGGTCCTAAACCTTAAAGAGAACAAGGGGGGGGAGGGCGCGAAGGGCGCTTTTATAGGTTTTGGTTTAACTGTTTTTATTTGTGGTTTTAAAGGGCGCTGGGGGCGGGAGGAGCAAAAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTGGCGGCGGCTGCT