ORFeome > itgb1bp2 ORF1 – XORFeome v1.0

itgb1bp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: itgb1bp2
Gene ID: 952366
Gene Page ID: 952359
ORF Xenbase ID: 17280729

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129684
Original XGC clone length: 1074

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TTCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCTTGCTGTGCTATAATAAAGGATGCGGACAAAAATTCAACCCCACAAAAAACAATGCAAATTCATGTCTTTTTCACCCTGGTTACCCCATATTTCATGATGCTTTGAAGGGCTGGTCATGCTGTAAAAAACGCACCACAAACTTCTCAAAATTTCTCGCTATTCCGGGATGCACTAAAGGAACACACAGCAACAAGAAACCCTCAAAACCAATAAAGCCTGAAATCTGTGGAAATAAGGGTGTATCAGGTTGTTCAAATCACACAACAAATATAATCGTACAAGGTCCCAAATCTGCAAAAAAAATGCTAAAGGAAAGGCCCATTGCTCAAAAACAAATGCAACCGCTTGTTCTCAAAGTGTCCCATTCACTTGAGAAGGAGCTGGAAAAACTGAGAATTAAACCACAAAAGAAAAAATTGAAAAAAGTTGAAACTGACCTTGTGGGTGTCGAAACATCATGTAAACATGCAGGCTGCAAAGAGGTTTATCAAGGGCCAAAAAGTGATGCAGGAACTTGTATACATCACCCTGGGGTGCGAGTTTTCATTGAAGGGATGAATTTCTGGTTCTTGTTTGAGCATCAAAACCCAATTAATTCAAAAAATTCCTGAATCAACGAAGAAGCCGCCTCAGGAAAAAACCTTATAGAAAAAAAAAAACGGCCAAAACGGGCATCCCTCTTTCCCTATTTATTGGCCACAAAAGCACCAAACAAAATTATCCATTATCCTTTTATATGCAAAAAAAGCCAATCCCCTGAAACCCAACCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCTTGCTGTGCTAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838691
dbEST ID: 79656393
Trimmed Sequence: GTCTGTGGGCTCCTCATCCTCAGACCAGCTCAGATCATCGTCTTCATCAGAAAACTCTGGTTCTGGTGGCTTCTCTGGGTTTTTTTGTGGCTCTTCTTCAGCTGTAATCTGCTGGGAATGGAGAGAAAGCTCCAGTCGCCCCCAGGTCACCGGATCAGCTTTCTTCAGTGTAATCTCCACCTTTGTGGGTAACAAATTGACAATACTTGCGCCCACGTCAATAACCCCCCACAACTCCACTTGTTTCCTAAACTCGCTTTGCCCCTGAAAGGAAATCTGAATGTCCAGCCCTGTCCGATTCGCTAGAACCTGGCTGAGCTCAGGAATCGCTGTCTTCGCATAAACGGTAATGGTAACTATGTTGCTGGTCTGGTGCCAGTCATAGCGACACGAGACTGCCTGTCTGCCTGTATTCTTTATCCAAAGGTGTTTCCCTGAGGCGCATCCTCGCTGATCCAGGAATTCATTGAAGTCACTGGTTTTGATGTTGCAACAAGACCAGAACTTCATCCCTTCATGGAAAACTGGCACCCCCGGGTGATGTATACGAGTTCCTGCATCACTTTCTGGCCCTTGAAAAACCTTTTTTCAGCCTGCCTGTTTAAATTAATGTTCCACACCCACAAGGGCCGTTTCCACTTTTCTCCCTTCTTCCCCCTTGTGTTTTAATTCTCAGTTTTTTCCAACTTCCCTCCTCAATTGACGGGGACCCATTTTAAAAACAACCGGGTTTGGCAATTGGGTTCGTAAGACCATTGGGGCGCCCC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTGTGGGCTCCTCATCCTCAGACCAGCTCAGATCATCGTCTTCATCAGAAAACTCTGGTTCTGGTGGCTTCTCTGGGTTTTTTTGTGGCTCTTCTTCAGCTGTAATCTGCTGGGAATGGAGAGAAAGCTCCAGTCGCCCCCAGGTCACCGGATCAGCTTTCTTCAGTGTAATCTCCACCTTTGTGGGTAACAAATTGACAATACTTGCGCCCACGTCAATAACCCCCCACAACTCCACTTGTTTCCTAAACTCGCTTTGCCCCTGAAAGGAAATCTGAATGTCCAGCCCTGTCCGATTCGCTAGAACCTGGCTGAGCTCAGGAATCGCTGTCTTCGCATAAACGGTAATGGTAACTATGTTGCTGGTCTGGTGCCAGTCATAGCGACACGAGACTGCCTGTCTGCCTGTATTCTTTATCCAAAGGTGTTTCCCTGAGGCGCATCCTCGCTGATCCAGGAATTCATTGAAGTCACTGGTTTTGATGTTGCAACAAGACCAGAACTTCATCCCTTCATGGAAAACTGGCACCCCCGGGTGATGTATACGAGTTCCTGCATCACTTTCTGGCCCTTGAAAAACCTTTTTTCAGCCTGCCTGTTTAAATTAATGTTCCACACCCACAAGGGCCGTTTCCACTTTTCTCCCTTCTTCCCCCTTGTGTTTTAATTCTCAGTTTTTTCCAACTTCCCTCCTCAATTGACGGGGACCCATTTTAAAAACAACCGGGTTTGGCAATTGGGTTCGTAAGACCATTGGGGCGCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTGTGGGCTCCTCATCCT