ORFeome > kiaa1841 ORF1 – XORFeome v1.0

kiaa1841 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: kiaa1841
Gene ID: 993257
Gene Page ID: 993251
ORF Xenbase ID: 17281335

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124960
Original XGC clone length: 2148

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ837346
dbEST ID: 79655048
Trimmed Sequence: ATGAGTCACAGATATTCTGAAAACAATAACTTTCCCTATGACAATAACCAGATGGTTTTAGACATGATCCTTTGTTCCCTGGTGGGTGTCCCGCAGCCCATCAGTTGGGACAGTGTTGCAAGGCTGGTTCCAGGATACACGCCAAAAGAGTGTGCCAAACGGTTTGAAGAGCTGAAGAGCAGCGGGACCTCTCCTGTTGATAATCAGTATAACCCTTTAATGGCAACTGGTGGGATACCTTTAGAAAGCTTGGCCTCATACATCAAGTCCTCCCTTCTGGATCCCGTGGATGACCAAGAGGATGTGACAGTGGGCCAAGGCACTATCTCTATAATAGGAAGGCCGGGTGCCACCACAGCACGGAAGTGTTCTGAGAGTGACAGGTGTTCCTCATCGCTGAAAGGAGACAGCACTACAGGAAGCCAGGGGCCTAACATGGTGATCCATGTGTGCGATGAAGCCAAAAACCTAAAGGAGGACTTTGTGTGCCCTCGAGACCTTTTGGTATCGGAGATGAAGTACTTTGCCGAATACTTGTCCACCGATGCTCAGCGCTTCGAGGAAGTGGATATATCTGTTCATTGTGATGTTCACATCTTTGATTGGCTGATGAGATACGTTAAACGTAGCGCTCCTGAAAATGAAAATCAGAAAATCCAAAATTTAAAACCTGGCATGTCACCTCAATCCAATTTTCTCCTTAATTTTTTTAGAATGAATCATTGGTAAAAGGAAAGGTTCCCGGATTTTTCCCCAAAACCATAAAGTCCCATTAAACCCCCCCCTTTTCCACCTTTCACTCCCCCCCTTCCC
Full Trace Sequence: CGTGGGCCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTCACAGATATTCTGAAAACAATAACTTTCCCTATGACAATAACCAGATGGTTTTAGACATGATCCTTTGTTCCCTGGTGGGTGTCCCGCAGCCCATCAGTTGGGACAGTGTTGCAAGGCTGGTTCCAGGATACACGCCAAAAGAGTGTGCCAAACGGTTTGAAGAGCTGAAGAGCAGCGGGACCTCTCCTGTTGATAATCAGTATAACCCTTTAATGGCAACTGGTGGGATACCTTTAGAAAGCTTGGCCTCATACATCAAGTCCTCCCTTCTGGATCCCGTGGATGACCAAGAGGATGTGACAGTGGGCCAAGGCACTATCTCTATAATAGGAAGGCCGGGTGCCACCACAGCACGGAAGTGTTCTGAGAGTGACAGGTGTTCCTCATCGCTGAAAGGAGACAGCACTACAGGAAGCCAGGGGCCTAACATGGTGATCCATGTGTGCGATGAAGCCAAAAACCTAAAGGAGGACTTTGTGTGCCCTCGAGACCTTTTGGTATCGGAGATGAAGTACTTTGCCGAATACTTGTCCACCGATGCTCAGCGCTTCGAGGAAGTGGATATATCTGTTCATTGTGATGTTCACATCTTTGATTGGCTGATGAGATACGTTAAACGTAGCGCTCCTGAAAATGAAAATCAGAAAATCCAAAATTTAAAACCTGGCATGTCACCTCAATCCAATTTTCTCCTTAATTTTTTTAGAATGAATCATTGGTAAAAGGAAAGGTTCCCGGATTTTTCCCCAAAACCATAAAGTCCCATTAAACCCCCCCCTTTTCCACCTTTCACTCCCCCCCTTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCACAGATATTCTGAAAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837345
dbEST ID: 79655047
Trimmed Sequence: TGTAGGCCGCCCTGTTCCAAAGCGAGGCTTGGGTCTGGGAATCTTTTCTGTGTTCATTTGTCGAGTATTGGAGTGAGCAGAGGCCTTGATCTGTGCTTCCAGCCTGGCGTATATACCCCCAGCTTGTTCTTTTCCTTCCTTGGCTTTGACACGTTCCAAGTCCCCGAGTCTTATTTTGATAAGGTGACCTGTGATTTCTGTCATCCTTCGTTGATCATCCTCCCTTTGGGCGTCTTGGTTAAATCTCAGAGAGCGAGACGCATCCCACTTATTCCTCTGCAGGCTAACTGTAAATGGAGATGAATCTCGAGAGGCCTTTTCCTGTTGCCTTTCCTTTTTATGGATACTTGGGGAGGAAATGTGCTTTTTTGTCTGTTTAGCAGATCTCTTTGGCTTCACTTTCCTCCCTGCTTGTTTTCTAGATAATTCTTCCTCATCTCCAACCTCATCTTCAGTGACTTCAGAACCAGTGGTATAATCCTCCTCTTCCGACAGCAAAGATTGTTGTTTCAGCTGTAGACTGATGTTCTTCATCGAAAGAAATGCATTCATCTCTCCTGTTTTCTGCCCATACAAAGTGTTTGGCTCTGACAGAGCATCACATTTTAAAACTTGGTTCCCTCGCTTAGGACAATCCCAGAGTCTCCCCTTCAGTCTTTGGAAAAAGGCACAGCTATAAAATCTCTACGCTTTAATAAATCCCTTAAAAATTTTAATTAAAAGGTTTTTCCCTCTAATTTGTTCCCCCCCTCTCGGGCAACCCCAACCAACTGTAAACCC
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTAGGCCGCCCTGTTCCAAAGCGAGGCTTGGGTCTGGGAATCTTTTCTGTGTTCATTTGTCGAGTATTGGAGTGAGCAGAGGCCTTGATCTGTGCTTCCAGCCTGGCGTATATACCCCCAGCTTGTTCTTTTCCTTCCTTGGCTTTGACACGTTCCAAGTCCCCGAGTCTTATTTTGATAAGGTGACCTGTGATTTCTGTCATCCTTCGTTGATCATCCTCCCTTTGGGCGTCTTGGTTAAATCTCAGAGAGCGAGACGCATCCCACTTATTCCTCTGCAGGCTAACTGTAAATGGAGATGAATCTCGAGAGGCCTTTTCCTGTTGCCTTTCCTTTTTATGGATACTTGGGGAGGAAATGTGCTTTTTTGTCTGTTTAGCAGATCTCTTTGGCTTCACTTTCCTCCCTGCTTGTTTTCTAGATAATTCTTCCTCATCTCCAACCTCATCTTCAGTGACTTCAGAACCAGTGGTATAATCCTCCTCTTCCGACAGCAAAGATTGTTGTTTCAGCTGTAGACTGATGTTCTTCATCGAAAGAAATGCATTCATCTCTCCTGTTTTCTGCCCATACAAAGTGTTTGGCTCTGACAGAGCATCACATTTTAAAACTTGGTTCCCTCGCTTAGGACAATCCCAGAGTCTCCCCTTCAGTCTTTGGAAAAAGGCACAGCTATAAAATCTCTACGCTTTAATAAATCCCTTAAAAATTTTAATTAAAAGGTTTTTCCCTCTAATTTGTTCCCCCCCTCTCGGGCAACCCCAACCAACTGTAAACCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTAGGCCGCCCTGTTC