ORFeome > leprot ORF1 – XORFeome v1.0

leprot ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: leprot
Gene ID: 970693
Gene Page ID: 970687
ORF Xenbase ID: 17282061

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078594
Original XGC clone length: 396

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ839936
dbEST ID: 79657638
Trimmed Sequence: ATGGCGGGGATTAAAGCACTTGTTGCATTATCCTTTAGTGGAGCCATTGGATTAACTTTCCTTATGTTGGGATGTGCCTTGGAAAGCTACAAGGTGTATTGGCCTTTGTTTGTTTTGATATTTTATACCATCAGTCCGATTCCATATTTTATTGCTACACGAATTAGTGATGATACAGATGCTGCCAGCAGTGCCTGCAGAGAACTGGCATTTTTCTTCACCACTGGAATCGTTGTCTCAGCGTTTGGCTTGCCCATAGTTCTGGCCAGAATTGGTGTGATTCTTTGGGGTGCCTGTGGACTGGTGCTTGCAGGGAATGCTGTTATTTTCCTTACAATACTGGGCTTTTTCATTGTGTTTGGAAGATCAGATGACTTTAGCTGGGAGCAGTGGTT
Full Trace Sequence: GGGGGTAGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGATTAAAGCACTTGTTGCATTATCCTTTAGTGGAGCCATTGGATTAACTTTCCTTATGTTGGGATGTGCCTTGGAAAGCTACAAGGTGTATTGGCCTTTGTTTGTTTTGATATTTTATACCATCAGTCCGATTCCATATTTTATTGCTACACGAATTAGTGATGATACAGATGCTGCCAGCAGTGCCTGCAGAGAACTGGCATTTTTCTTCACCACTGGAATCGTTGTCTCAGCGTTTGGCTTGCCCATAGTTCTGGCCAGAATTGGTGTGATTCTTTGGGGTGCCTGTGGACTGGTGCTTGCAGGGAATGCTGTTATTTTCCTTACAATACTGGGCTTTTTCATTGTGTTTGGAAGATCAGATGACTTTAGCTGGGAGCAGTGGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATATTGAGTCGTATTACATGGTCATAAAAAAATCCTGAAAAATCTAAAACATGTCTAAAATCGGGGGAAATTACAAAAAAACAAAAAAGAAATTCCAAAAATTCGGCTTACCCTTTTTTTTTGTTTTTACTATACCGTTAAAAAAAAAAAAAAAAAAACCCGGGAAAAATAAATTTTTTTTTTCTACCCCCCCCTAGGGAGGATCGTGAGTTTTTCCCCCCCCCTCTTCTCAACCCTCTTCTCCATCGCCCCCGCGGTTGGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGATTAAAGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839935
dbEST ID: 79657637
Trimmed Sequence: CCACTGCTCCCAGCTAAAGTCATCTGATCTTCCAAACACAATGAAAAAGCCCAGTATTGTAAGGAAAATAACAGCATTCCCTGCAAGCACCAGTCCACAGGCACCCCAAAGAATCACACCAATTCTGGCCAGAACTATGGGCAAGCCAAACGCTGAGACAACGATTCCAGTGGTGAAGAAAAATGCCAGTTCTCTGCAGGCACTGCTGGCAGCATCTGTATCATCACTAATTCGTGTAGCAATAAAATATGGAATCGGACTGATGGTATAAAATATCAAAACAAACAAAGGCCAATACACCTTGTAGCTTTCCNAGGCACATCCCAACATAAGGAAAGTTAATCCAATGGCTCCACTAAAGGATAATGCAACAAGTGCTTTAATCCCCGCCATGG
Full Trace Sequence: GAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCACTGCTCCCAGCTAAAGTCATCTGATCTTCCAAACACAATGAAAAAGCCCAGTATTGTAAGGAAAATAACAGCATTCCCTGCAAGCACCAGTCCACAGGCACCCCAAAGAATCACACCAATTCTGGCCAGAACTATGGGCAAGCCAAACGCTGAGACAACGATTCCAGTGGTGAAGAAAAATGCCAGTTCTCTGCAGGCACTGCTGGCAGCATCTGTATCATCACTAATTCGTGTAGCAATAAAATATGGAATCGGACTGATGGTATAAAATATCAAAACAAACAAAGGCCAATACACCTTGTAGCTTTCCNAGGCACATCCCAACATAAGGAAAGTTAATCCAATGGCTCCACTAAAGGATAATGCAACAAGTGCTTTAATCCCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAGAACTTAAAAAAAAAACGACATTATACAACAAAAATGACAGTGGCCGCCCCTAAAAAAAAACAGAAAGGAAAATCCTAAAAATGGCCTCTTATCTTAGTGTGGGGGGGGTGGGCGAGCACCGGGGGAAACCGGAAAAAAAGGAACCAACCCCAAGGGGAACATATAAACCGGGTTCGGGGTACTAAAAACTTTAAAAAAGAAAAAAAAAAACGGAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCACTGCTCCCAGCTAA