ORFeome > lgalsia-a ORF1 – XORFeome v1.0

lgalsia-a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6253068
Gene Page ID:
ORF Xenbase ID: 17282115

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128962
Original XGC clone length: 405

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ838986
dbEST ID: 79656688
Trimmed Sequence: ATGTCAGCTGGAATGGTCATGAGCAACTTTAGCCTGAAGCAGGGCCACTGCTTGGAACTGAAAGGGAATAATTCCCAAAGATGCTAAAAGCTTTGCAATAAACCTGGGCAAAGACAGTTCCAACTATGTCATTCACTTTAATCCTCGATTTGACCACCACGGAGACACAAATAAGATCATCTGCAACTCAAAAGAAGAAAACCACTGGGGGAAAGAGCAGAGAGAAAACGCTTTCCCATTCCAGCAGGGAGCGGAGACAACGATTTGTTTTGAGTATCAAGCAGACCATTTAAAGGTGAAGTTATCTGATGGAAAAGAATTCAACTTCCCCATCCGAATGCCCTTGGATACCATTACATTTCTCACTATGGATGGAATAGAGCTCAAATCTTTCTCGCTTCATTT
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGCTGGAATGGTCATGAGCAACTTTAGCCTGAAGCAGGGCCACTGCTTGGAACTGAAAGGGAATAATTCCCAAAGATGCTAAAAGCTTTGCAATAAACCTGGGCAAAGACAGTTCCAACTATGTCATTCACTTTAATCCTCGATTTGACCACCACGGAGACACAAATAAGATCATCTGCAACTCAAAAGAAGAAAACCACTGGGGGAAAGAGCAGAGAGAAAACGCTTTCCCATTCCAGCAGGGAGCGGAGACAACGATTTGTTTTGAGTATCAAGCAGACCATTTAAAGGTGAAGTTATCTGATGGAAAAGAATTCAACTTCCCCATCCGAATGCCCTTGGATACCATTACATTTCTCACTATGGATGGAATAGAGCTCAAATCTTTCTCGCTTCATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCCTGTAAAAAAAAAAAAAAAAGACCGTGACTCAAACTTTGAAAAAGTTACAGGGGGGGGGGGGGGGGTGTTTTTTTTTTTGGGGTGCTTCGGGGGTGCGAAAAAAAAAAAAAAAATAATATAAAAGAGAACAAACCCCGGTGGAAAAAACGGGTCCGGCGCGAGGGGTGTAATGCGTTCGCGTTGCCCCCCCAACCACGGGCCGAAACCTGTTAAAAACCACGGGGGGAAAAGGGGGATTTGGGGTGTTTTTTGGTCTTTTTATAAATGTTATTTGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGCTGGAATGGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838985
dbEST ID: 79656687
Trimmed Sequence: ATGAAGCGAGAAAGATTTGAGCTCTATTCCATCCATAGTGAGAAATGTAATGGTATCCAAGGGCATTCGGATGGGGAAGTTGAATTCTTTTCCATCAGATAACTTCACCTTTAAATGGTCTGCTTGATACTCAAAACAAATCGTTGTCTCCGCTCCCTGCTGGAATGGGAAAGCGTTTTCTCTCTGCTCTTTCCCCCAGTGGTTTTCTTCTTTTGAGTTGCAGATGATCTTATTTGTGTCTCCGTGGTGGTCAAATCGAGGATTAAAGTGAATGACATAGTTGGAACTGTCTTTGCCCAGGTTTATTGCAAAGCTTTTAGCATCTTTGGTAATAATACCTTTCAGTTCCAAACAGTGGCCCTGCTTCAAGCTAAAGTTGCTCATGACCATTCCAGCTGACTTGG
Full Trace Sequence: GGAAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGAAGCGAGAAAGATTTGAGCTCTATTCCATCCATAGTGAGAAATGTAATGGTATCCAAGGGCATTCGGATGGGGAAGTTGAATTCTTTTCCATCAGATAACTTCACCTTTAAATGGTCTGCTTGATACTCAAAACAAATCGTTGTCTCCGCTCCCTGCTGGAATGGGAAAGCGTTTTCTCTCTGCTCTTTCCCCCAGTGGTTTTCTTCTTTTGAGTTGCAGATGATCTTATTTGTGTCTCCGTGGTGGTCAAATCGAGGATTAAAGTGAATGACATAGTTGGAACTGTCTTTGCCCAGGTTTATTGCAAAGCTTTTAGCATCTTTGGTAATAATACCTTTCAGTTCCAAACAGTGGCCCTGCTTCAAGCTAAAGTTGCTCATGACCATTCCAGCTGACTTGGTGCCGACTTTTTTGTACAACGTTGGCATTATAAAGAAGCGTTGCTCATCAATTTGTTTGCACCCAACAGTCACTATCAGTCAAAATAAAATCATTTTTTGCGGCCGAAAAAAAAAAAAAGAAAACGTTCACAAAATCCGTCACTGGCGAGAAGGGGCNGGACAAGTTGACNNGAAGGTGAAGCAGGAAAAAGAAAGGAGACAAAAATAGGAATTGGTGTAGGGNGACGCGNGGGGGNGTTCTACGCGCCGGCANAAAGGNTGGGGGGTGGNGCNAGCGGCCTAGCCCCGGTGCCGCTGGTGTTCGCCTTAGAAAGAANTGGNNGNGGNGGTGTTGAGGNNGTANAAGGGGGGANNNGGANNNGNNAAATTTTCCNGGAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGAAGCGAGAAAGATTTGAGC