ORFeome > LOC100125664 ORF1 – XORFeome v1.0

LOC100125664 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256138
Gene Page ID:
ORF Xenbase ID: 17254893

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123186
Original XGC clone length: 1512

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ838102
dbEST ID: 79655804
Trimmed Sequence: ATGGCACAGCAGACTCATCCCATCTTGACTACAGGAGCCGGAATCCCCACCGGGGATAAGCTCAATGTTCTGACGGCCGGCCCCCGGGGGCCAATGCTGATGCAGGATGTGGTGTTCACCGATGAGATGGCGCATTTTGACCGGGAAAGGATTCCAGAAAGAGTTGTACATGCAAAAGGAGCGGGAGCGTTCGGGTATTTCGAGGTGACACACGACATCACAAAGTACTGCAGGGCCAAGGTGTTTGAAAAAGTTGGGAAAAGGACGGACGTTGCAGTGAGATTTTCAACAGTTGCTGGGGAAGCAAGATCAGCAGATACTGTCCGTGACCCTCGGGGTTTCGCAGTGAAATTCTACACGGAAGAAGGAATCTGGGACCTGGTTGGAAACAACATCCCCATTTTCTTCCTCAGAGATCCCATGATGTTTCCATCGTTCATCCACAGTCAGAAGAGAAACCCACAGACACACCTGAAAGATCCAGATACAGTTTGGGATTTCTGGAGCCTGCGTCCGGAGACTCTGCATCATGTGACTTTCCTGTTCAGTGACCGCGGAATCCCATATGGGCACAGACATATGAATGGCTACGGGTCTCACACGTTCAAGCTTGTGAATGCAGAAGGAAATGCAGTTTAACTGCAGTTTCCTTATAAGACGGATCAGGGGAATAAGAATCTTTTAGTATAAGAAACATAACAAAATTGGTGGTGAGGTGGACCCAAAATACGGACACCAAAAAATTAATTTCAGGCCCTTCTCCAAGGAAGAAATTTCCCCATCTTGGAAACAGTGTTAATTTCCGGGTTCTGGGCCCTTTTTATGAGAAGCAAAAAA
Full Trace Sequence: GGCCCCAAATAATAGATTTTGATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACAGCAGACTCATCCCATCTTGACTACAGGAGCCGGAATCCCCACCGGGGATAAGCTCAATGTTCTGACGGCCGGCCCCCGGGGGCCAATGCTGATGCAGGATGTGGTGTTCACCGATGAGATGGCGCATTTTGACCGGGAAAGGATTCCAGAAAGAGTTGTACATGCAAAAGGAGCGGGAGCGTTCGGGTATTTCGAGGTGACACACGACATCACAAAGTACTGCAGGGCCAAGGTGTTTGAAAAAGTTGGGAAAAGGACGGACGTTGCAGTGAGATTTTCAACAGTTGCTGGGGAAGCAAGATCAGCAGATACTGTCCGTGACCCTCGGGGTTTCGCAGTGAAATTCTACACGGAAGAAGGAATCTGGGACCTGGTTGGAAACAACATCCCCATTTTCTTCCTCAGAGATCCCATGATGTTTCCATCGTTCATCCACAGTCAGAAGAGAAACCCACAGACACACCTGAAAGATCCAGATACAGTTTGGGATTTCTGGAGCCTGCGTCCGGAGACTCTGCATCATGTGACTTTCCTGTTCAGTGACCGCGGAATCCCATATGGGCACAGACATATGAATGGCTACGGGTCTCACACGTTCAAGCTTGTGAATGCAGAAGGAAATGCAGTTTAACTGCAGTTTCCTTATAAGACGGATCAGGGGAATAAGAATCTTTTAGTATAAGAAACATAACAAAATTGGTGGTGAGGTGGACCCAAAATACGGACACCAAAAAATTAATTTCAGGCCCTTCTCCAAGGAAGAAATTTCCCCATCTTGGAAACAGTGTTAATTTCCGGGTTCTGGGCCCTTTTTATGAGAAGCAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACAGCAGACTCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ838101
dbEST ID: 79655803
Trimmed Sequence: CACCCGGGCGGCTTTATGACAAATGTAGTTGTGCAACGTCTCCTTCTTTCCACCTTCAGCGTTAAATTTATCCAGCAGGGCCTTTATATCCGCACCATAATCTGGGTGAATGTTACTGAAATTTTTAACAGCTCTTTCTTGGATGAAGATCTGAGCTTCACTTAAGTTTCGGGCGAGATTCTCGCACAGTCGCTGACGCTCCTCTTCAGTCAGAGTCTGAGTGTAGAATGCTCTCACCTGAGACACATTGTCCTCATCACTACAGTCATGTCGATCCACATCTCCTGAGGCCACAAACGTGGAGTCTTTGCACTTTGGATCATCCCGTGGGGAACTGAAGCTGTTTGGATAGTAATTCGGCATATGGCTAGGGGTATTAAACATGCACATGGGCCCATCCCGCTGGTAATGAGCCACTTTCACTCCCCGGGGACAGTTGACAGGAAGGTGCAAGTAGTTTGGTCCCAAGCGATACCGGTGAGTATCCGGGTATGAGAACAGGCGACCCTGTAACATTTTATCCGGGCTCGCTTCAATCCCAGGGGGCATGTGGCTTGGGTCGAATGCAATCTGTTCCACCTCGGGCAAGTAATTCTCTGGGTTTCTGTTCAGTACCAGTTTGCCCATTGGGGAATAATTGGGTAATCTTTGTGCGGCCAGACCCTTAGTTAAGTCAAATGAATTGGAAAGGAAATTTCTCTTGCTCCCTCCAAGGGCCAAGAACTTGAAATTTAAATTGGTCCCCCAAAAATGGGGAAATTTCCCTTTTTTTGGCGAA
Full Trace Sequence: GGGAAACAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACCCGGGCGGCTTTATGACAAATGTAGTTGTGCAACGTCTCCTTCTTTCCACCTTCAGCGTTAAATTTATCCAGCAGGGCCTTTATATCCGCACCATAATCTGGGTGAATGTTACTGAAATTTTTAACAGCTCTTTCTTGGATGAAGATCTGAGCTTCACTTAAGTTTCGGGCGAGATTCTCGCACAGTCGCTGACGCTCCTCTTCAGTCAGAGTCTGAGTGTAGAATGCTCTCACCTGAGACACATTGTCCTCATCACTACAGTCATGTCGATCCACATCTCCTGAGGCCACAAACGTGGAGTCTTTGCACTTTGGATCATCCCGTGGGGAACTGAAGCTGTTTGGATAGTAATTCGGCATATGGCTAGGGGTATTAAACATGCACATGGGCCCATCCCGCTGGTAATGAGCCACTTTCACTCCCCGGGGACAGTTGACAGGAAGGTGCAAGTAGTTTGGTCCCAAGCGATACCGGTGAGTATCCGGGTATGAGAACAGGCGACCCTGTAACATTTTATCCGGGCTCGCTTCAATCCCAGGGGGCATGTGGCTTGGGTCGAATGCAATCTGTTCCACCTCGGGCAAGTAATTCTCTGGGTTTCTGTTCAGTACCAGTTTGCCCATTGGGGAATAATTGGGTAATCTTTGTGCGGCCAGACCCTTAGTTAAGTCAAATGAATTGGAAAGGAAATTTCTCTTGCTCCCTCCAAGGGCCAAGAACTTGAAATTTAAATTGGTCCCCCAAAAATGGGGAAATTTCCCTTTTTTTGGCGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCCGGGCGGCTTTATGA