ORFeome > LOC594870 ORF1 – XORFeome v1.0

LOC594870 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: unnamed
Gene ID: 5865448
Gene Page ID: 5865391
ORF Xenbase ID: 17256699

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084379
Original XGC clone length: 720

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ839957
dbEST ID: 79657659
Trimmed Sequence: ATGTCCTGGGCTGTCCTCCTCCTCTCTCTCACCTCTCTCTGTACATATTCGGCTGCCCAAGTCTCTATAACTCAACCAGTATCTGAATCAGTGAAATTGGGAGAGACAGTGAGAATCTCCTGCACACTCAGTGGTGCCAGTATCGGTGATCTCCATATGTGCTGGTACCAGCAGAAAGCAGGGAATCGCCCCAGATACTTGTTACGTTTCTATTCAGACTCAAGCAAACACCAGGGAGATGGGGTACCTGATCGGTTCTCTGGATCCAAAGATTCCCCTAATAATGTTGGCTATTTAACCATTAAAGGAGCCTTACTAGAAGATGATGCAGATTATTACTGTGCTACGTGGCATGCCAGCTCGTTTATATTCGGTGGTGGAACCCAGCTGACCGTCCTCACAGGTGACGTGAAAGCCCCTTCAGTGTCCATCTTTGCTCCCTCCGAGGAAGAAATAGCCACCAAAAAGGCAACAGTGGTCTGCAGTCTGAGTGATTTCACCCCCAGAGGTGCCACAGTGAAGTGGCTGGTGGATGGGAAAGAAAAGACTGACAGTGTTCAGTCCTCAGGGCTCAGCAAACAGAGTGACAACCTGTATATGGAGAGCAGTTATCTGTCCCTGACTGCAGATCAATGGCTCAAACATGAAAACCTATTCCTGCAAAGTCTCCCATCAGGGCAAGGAAATAATCCAAAACGCTGAAAAAATCAAAACTGTTCAATGCCCACCTTTCCTGTAACAAATTTGGCATTAAAAAAAAAACATTGCCTTAATCAATTTGGTTTCCAACAAACAG
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTGGGCTGTCCTCCTCCTCTCTCTCACCTCTCTCTGTACATATTCGGCTGCCCAAGTCTCTATAACTCAACCAGTATCTGAATCAGTGAAATTGGGAGAGACAGTGAGAATCTCCTGCACACTCAGTGGTGCCAGTATCGGTGATCTCCATATGTGCTGGTACCAGCAGAAAGCAGGGAATCGCCCCAGATACTTGTTACGTTTCTATTCAGACTCAAGCAAACACCAGGGAGATGGGGTACCTGATCGGTTCTCTGGATCCAAAGATTCCCCTAATAATGTTGGCTATTTAACCATTAAAGGAGCCTTACTAGAAGATGATGCAGATTATTACTGTGCTACGTGGCATGCCAGCTCGTTTATATTCGGTGGTGGAACCCAGCTGACCGTCCTCACAGGTGACGTGAAAGCCCCTTCAGTGTCCATCTTTGCTCCCTCCGAGGAAGAAATAGCCACCAAAAAGGCAACAGTGGTCTGCAGTCTGAGTGATTTCACCCCCAGAGGTGCCACAGTGAAGTGGCTGGTGGATGGGAAAGAAAAGACTGACAGTGTTCAGTCCTCAGGGCTCAGCAAACAGAGTGACAACCTGTATATGGAGAGCAGTTATCTGTCCCTGACTGCAGATCAATGGCTCAAACATGAAAACCTATTCCTGCAAAGTCTCCCATCAGGGCAAGGAAATAATCCAAAACGCTGAAAAAATCAAAACTGTTCAATGCCCACCTTTCCTGTAACAAATTTGGCATTAAAAAAAAAACATTGCCTTAATCAATTTGGTTTCCAACAAACAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTGGGCTGTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839956
dbEST ID: 79657658
Trimmed Sequence: TGAACAGTCTGATCTTTTCAGCGTCTGGATTATTTCCTTGCCCTGATGGGAGACTTTGCAGGAATAGGTTTCATGTTTGAGCCATTGATCTGCAGTCAGGGACAGATAACTGCTCTCCATATACAGGTTGTCACTCTGTTTGCTGAGCCCTGAGGACTGAACACTGTCAGTCTTTTCTTTCCCATCCACCAGCCACTTCACTGTGGCACCTCTGGGGGTGAAATCACTCAGACTGCAGACCACTGTTGCCTTTTTGGTGGCTATTTCTTCCTCGGAGGGAGCAAAGATGGACACTGAAGGGGCTTTCACGTCACCTGTGAGGACGGTCAGCTGGGTTCCACCACCGAATATAAACGAGCTGGCATGCCACGTAGCACAGTAATAATCTGCATCATCTTCTAGTAAGGCTCCTTTAATGGTTAAATAGCCNACATTATTAGGGGAATCTTTGGATCCNGAGAACCGATCAGGTACCCCATCTCCCTGGTGTTTGCTTGAGTCTGAATAGAAACGTAACAAGTATCTGGGGCGATTCCCTGCTTTCTGCTGGTACCAGCACATATGGAAATCACCGATACTGGGCACCACTGATGTGCAGGAAAATCTCACTGTCCCTCCCCATTTCCCTTATTTAGAAACCGGTTTGATTTAGAGAAACTTTGGGCAGCCAAATATGTACGGGAGAAAAGTTGAAAATAAGTGAGGTAGGACTTTCTAAG
Full Trace Sequence: GAGACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAACAGTCTGATCTTTTCAGCGTCTGGATTATTTCCTTGCCCTGATGGGAGACTTTGCAGGAATAGGTTTCATGTTTGAGCCATTGATCTGCAGTCAGGGACAGATAACTGCTCTCCATATACAGGTTGTCACTCTGTTTGCTGAGCCCTGAGGACTGAACACTGTCAGTCTTTTCTTTCCCATCCACCAGCCACTTCACTGTGGCACCTCTGGGGGTGAAATCACTCAGACTGCAGACCACTGTTGCCTTTTTGGTGGCTATTTCTTCCTCGGAGGGAGCAAAGATGGACACTGAAGGGGCTTTCACGTCACCTGTGAGGACGGTCAGCTGGGTTCCACCACCGAATATAAACGAGCTGGCATGCCACGTAGCACAGTAATAATCTGCATCATCTTCTAGTAAGGCTCCTTTAATGGTTAAATAGCCNACATTATTAGGGGAATCTTTGGATCCNGAGAACCGATCAGGTACCCCATCTCCCTGGTGTTTGCTTGAGTCTGAATAGAAACGTAACAAGTATCTGGGGCGATTCCCTGCTTTCTGCTGGTACCAGCACATATGGAAATCACCGATACTGGGCACCACTGATGTGCAGGAAAATCTCACTGTCCCTCCCCATTTCCCTTATTTAGAAACCGGTTTGATTTAGAGAAACTTTGGGCAGCCAAATATGTACGGGAGAAAAGTTGAAAATAAGTGAGGTAGGACTTTCTAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAACAGTCTGATCTTTTCAGCGT