ORFeome > LOC733268 ORF1 – XORFeome v1.0

LOC733268 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5733159
Gene Page ID: 5733004
ORF Xenbase ID: 17256729

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123292
Original XGC clone length: 735

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ837499
dbEST ID: 79655201
Trimmed Sequence: ATGGATTTGGGATTTGTGGCCACCGCTCAGGGTAGCTCTTCTCCCTGTTCCTCACAGATTGAACAGCTTGATCATAGAACCCGTCCAAAGTCTGGGGGGTCGCCATTCCTGCTTAAGGTTTCTGAGTCAACTCCGCTTGTAAGTGGAGGGAAGCAGCGACTGACCGTTGAGGAAATCCTGCCGTGCCTAAGCAGGTCTCCTCTACCACCACCCGATGGTCAGGTGTTTGAACTGTCCACTTTAGCCCCAGAACCACTAAGTAACTCTATAGTTGGGGTATTCTATGGCGCCAAAGTGTCAACTCCCTATAAGGAAGAGACCACTGATGCAATATGTGTGGACATCCAAGTACCTAAACTACAAGATTCAGAGATGGTGGTCCAGGCTGTAGGTGTACAGAAGCCTTCTGCCCCACCAATATGGGAGCTCTCCGAGATTAACTCTGCATTAGAAGAGAACACGCCAACTCTGGATGTTTCTGTCTCTGATTTGAGGTACGTTGGTGGTTCTGATCGAGACCAACCTCCAAATCCACAGGTTCCAGCTTCTCAATGTAACCAGTGGGTTGGGATCACGCATAAGGATGTGGGGCGCTCCTATTTACAGCCATTCCGCTACCAACGCCCACTTAGTGCCTCTGAAATCCAAGTTACCTCAAAAACCCCCCCTGCTCCCAAACTTCCATTTGTCTTCTGAAGAGGTGGGAACAAAGTGGGAACCTGAAAATGAAACACCTGGCCAAATTTCTTTGAACAAATTTGGCATTTAAAAAAAAAACATTGCTTAATAAAATTTTGTTGTCTAAAAA
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGNTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTTGGGATTTGTGGCCACCGCTCAGGGTAGCTCTTCTCCCTGTTCCTCACAGATTGAACAGCTTGATCATAGAACCCGTCCAAAGTCTGGGGGGTCGCCATTCCTGCTTAAGGTTTCTGAGTCAACTCCGCTTGTAAGTGGAGGGAAGCAGCGACTGACCGTTGAGGAAATCCTGCCGTGCCTAAGCAGGTCTCCTCTACCACCACCCGATGGTCAGGTGTTTGAACTGTCCACTTTAGCCCCAGAACCACTAAGTAACTCTATAGTTGGGGTATTCTATGGCGCCAAAGTGTCAACTCCCTATAAGGAAGAGACCACTGATGCAATATGTGTGGACATCCAAGTACCTAAACTACAAGATTCAGAGATGGTGGTCCAGGCTGTAGGTGTACAGAAGCCTTCTGCCCCACCAATATGGGAGCTCTCCGAGATTAACTCTGCATTAGAAGAGAACACGCCAACTCTGGATGTTTCTGTCTCTGATTTGAGGTACGTTGGTGGTTCTGATCGAGACCAACCTCCAAATCCACAGGTTCCAGCTTCTCAATGTAACCAGTGGGTTGGGATCACGCATAAGGATGTGGGGCGCTCCTATTTACAGCCATTCCGCTACCAACGCCCACTTAGTGCCTCTGAAATCCAAGTTACCTCAAAAACCCCCCCTGCTCCCAAACTTCCATTTGTCTTCTGAAGAGGTGGGAACAAAGTGGGAACCTGAAAATGAAACACCTGGCCAAATTTCTTTGAACAAATTTGGCATTTAAAAAAAAAACATTGCTTAATAAAATTTTGTTGTCTAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTTGGGATTTGTGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837498
dbEST ID: 79655200
Trimmed Sequence: GGTGGTCATCTCCAGCTGCCACTCTGCTCCCACCTCATCAGCAGACAAATGGAAGTTATGGAGCAAGGGCGTGTTTGAGGTAACTTGGATTTCAGAGGCACTAAGTTGGCGTTGGTAGCGGAATGGCTGTAAATAGGAGCGCCCCACATCCTTATGCGTGATCCCAACCCACTGGTTACATTGAGAAGCTGGAACCTGTGGATTTGGAGGTTGGTCTCGATCAGAACCACCAACGTACCTCAAATCAGAGACAGAAACATCCAGAGTTGGCGTGTTCTCTTCTAATGCAGAGTTAATCTCGGAGAGCTCCCATATTGGTGGGGCAGAAGGCTTCTGTACACCTACAGCCTGGACCACCATCTCTGAATCTTGTAGTTTAGGTACTTGGATGTCCACACATATTGCATCAGTGGTCTCTTCCTTATAGGGAGTTGACACTTTGGCGCCATACAATACCCCAACTATACAGTTACTTAGTGGTTCTGGGGCTAAGGTGGACAGTTGAAACACCTGACCATCGGGTGGTGGGGAGAGGAGACCGGCTTATGCACGGCAGGATTTCCTCAACGCTCACTCCCTTCCTTCCCTCCCTTTACAACCCTATTTGACTCAAAAAGCCTTAAACACTAATGGGCAACCCCGCGAAACTTGGAACCGGGTTCTGGAAGGGGGCTGATTAAAACGGTTAAGGGAAAAGGGGGAAGAAGGGGGGCGGGGAAACGAAAGGCCACGAAGATCCCAGAAGGGAACTATAGGCCCAAGGGTGGT
Full Trace Sequence: GAGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGTGGTCATCTCCAGCTGCCACTCTGCTCCCACCTCATCAGCAGACAAATGGAAGTTATGGAGCAAGGGCGTGTTTGAGGTAACTTGGATTTCAGAGGCACTAAGTTGGCGTTGGTAGCGGAATGGCTGTAAATAGGAGCGCCCCACATCCTTATGCGTGATCCCAACCCACTGGTTACATTGAGAAGCTGGAACCTGTGGATTTGGAGGTTGGTCTCGATCAGAACCACCAACGTACCTCAAATCAGAGACAGAAACATCCAGAGTTGGCGTGTTCTCTTCTAATGCAGAGTTAATCTCGGAGAGCTCCCATATTGGTGGGGCAGAAGGCTTCTGTACACCTACAGCCTGGACCACCATCTCTGAATCTTGTAGTTTAGGTACTTGGATGTCCACACATATTGCATCAGTGGTCTCTTCCTTATAGGGAGTTGACACTTTGGCGCCATACAATACCCCAACTATACAGTTACTTAGTGGTTCTGGGGCTAAGGTGGACAGTTGAAACACCTGACCATCGGGTGGTGGGGAGAGGAGACCGGCTTATGCACGGCAGGATTTCCTCAACGCTCACTCCCTTCCTTCCCTCCCTTTACAACCCTATTTGACTCAAAAAGCCTTAAACACTAATGGGCAACCCCGCGAAACTTGGAACCGGGTTCTGGAAGGGGGCTGATTAAAACGGTTAAGGGAAAAGGGGGAAGAAGGGGGGCGGGGAAACGAAAGGCCACGAAGATCCCAGAAGGGAACTATAGGCCCAAGGGTGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTGGTCATCTCCAGCT