ORFeome > MGC64538 ORF1 – XORFeome v1.0

MGC64538 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255793
Gene Page ID:
ORF Xenbase ID: 17258529

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054289
Original XGC clone length: 459

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ839329
dbEST ID: 79657031
Trimmed Sequence: ATGGAGAACAGCGGTTATGGTCGTCAGATTAACGGGTCACCGTCTCTCTATGGAAGCCCGGGCTATGAGCCGTTAAGGGAAGAGATGGAGTACCGAGGGGGCCCGGGAATGCAAATACAGTCCACTGTAGTGACCATAAACTCGGAAGGACCCCCTGTGCGGGACCACTTGGTCTGGTCCATCTTTAATACCCTCTACTTCAACTTCTGCTGCCTGGGATTACTCGCTATGCTCTACTCTGTCAAGTCACGTGATAGAAAAGTGATGGGAGACAGAAGTGGAGCCATGAGTTTCGCTGGCACTGCCCGAGGATTGAACATCACAGCCACCCTGCTGAGCATTCTCTCATGTATTGTTATAATTATTCTTTTGGTCACTGGAGTCATCACCGTAGTACATGCCGCTCAAACTTACCCCAATCCACACAATCCTAACAACATGAACCCCTGGGGGAACTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAACAGCGGTTATGGTCGTCAGATTAACGGGTCACCGTCTCTCTATGGAAGCCCGGGCTATGAGCCGTTAAGGGAAGAGATGGAGTACCGAGGGGGCCCGGGAATGCAAATACAGTCCACTGTAGTGACCATAAACTCGGAAGGACCCCCTGTGCGGGACCACTTGGTCTGGTCCATCTTTAATACCCTCTACTTCAACTTCTGCTGCCTGGGATTACTCGCTATGCTCTACTCTGTCAAGTCACGTGATAGAAAAGTGATGGGAGACAGAAGTGGAGCCATGAGTTTCGCTGGCACTGCCCGAGGATTGAACATCACAGCCACCCTGCTGAGCATTCTCTCATGTATTGTTATAATTATTCTTTTGGTCACTGGAGTCATCACCGTAGTACATGCCGCTCAAACTTACCCCAATCCACACAATCCTAACAACATGAACCCCTGGGGGAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGGCTGATATCCACTATAGTGAGTCGTATTACATGGGTCTAACCTGGTTTCATAAAAAAATAAAGACCGTGTCTATAAATCACGTGATGGTACAACCACGCGGAAAAAAAAAGCCGCGCGCTCTCTGCGCAACCGGGGGTCGCGGTGTTTTCCCGCCTGTGGAGGGGAAAAAAAGAAAAAAAAAAAGAAGAAAAAAAAGGTTGGGTGGGTTTTTTTGTTGGTGGAACGGAGACGCGCGGGGGGGCGGCGCGCGAGGGAGATAGAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAACAGCGGTTATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839328
dbEST ID: 79657030
Trimmed Sequence: GTTCCCCCAGGGGTTCATGTTGTTAGGATTGTGTGGATTGGGGTAAGTTTGAGCGGCATGTACTACGGTGATGACTCCAGTGACCAAAAGAATAATTATAACAATACATGAGAGAATGCTCATCAGGGTGGCTGTGATGTTCAATCCTCGGGCAGTGCCAGCGAAACTCATGGCTCCACTTCTGTCTCCCATCACTTTTCTATCACGTGACTTGACAGAGTAAAGCATATCGAGTAATCCCAGGCAGCATAAGTTGAAGTAGAGGGTATTAAATATGGACCACACAAAGTGGTCCCGCACAGGGGGTCCTTCCGAGTTTATGGTCACTACAGTGGACTGTATTTGCATTCCCGGGCCCCCTCGGTACTCCATCTCTTCCCTTAACGGCTCATAGCCCGGCCTTCCATAGAGAGACGGTGACCCGTTAATCTGACAACCATAACAACTGTTCTCCATGG
Full Trace Sequence: CGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCCCCCAGGGGTTCATGTTGTTAGGATTGTGTGGATTGGGGTAAGTTTGAGCGGCATGTACTACGGTGATGACTCCAGTGACCAAAAGAATAATTATAACAATACATGAGAGAATGCTCATCAGGGTGGCTGTGATGTTCAATCCTCGGGCAGTGCCAGCGAAACTCATGGCTCCACTTCTGTCTCCCATCACTTTTCTATCACGTGACTTGACAGAGTAAAGCATATCGAGTAATCCCAGGCAGCATAAGTTGAAGTAGAGGGTATTAAATATGGACCACACAAAGTGGTCCCGCACAGGGGGTCCTTCCGAGTTTATGGTCACTACAGTGGACTGTATTTGCATTCCCGGGCCCCCTCGGTACTCCATCTCTTCCCTTAACGGCTCATAGCCCGGCCTTCCATAGAGAGACGGTGACCCGTTAATCTGACAACCATAACAACTGTTCTCCATGGTGCCGACTTTTTTGTACAAGTTGGCAGTAAAAAAAAGCATTGCTCATCAATTTGCTGCCACGAACAAGTCACTATCAGTCCAAATAAAATCATTATTTTGGGGTCCGAGAAACAACAAGCCAATCGTTCAAATCTCTGGTGAATTGGATAATACCAGGATACTCAAGCCCGTGTCTCNAACTTACCGCGTCTGGAAATTTGGTTGCCTTGAGGCAAAAAAAAACAAACACAACAAAAGAGCAACACGCCGGGTTAATATCATATAGTGGGAAATAAACGACCGCGACGGCGAGACNCCCCNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCCCCCAGGGGTTCA