ORFeome > mmp8 ORF1 – XORFeome v1.0

mmp8 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: mmp8
Gene ID: 952403
Gene Page ID: 952401
ORF Xenbase ID: 17284389

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084836
Original XGC clone length: 1401

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ840036
dbEST ID: 79657738
Trimmed Sequence: ATGAAGTCCTGGATTCTTTTGCTGAATTCGTACTGTCGATTGCCATTGAAGAAAAATTGCAAATGGATAAAGACTCTCCTCGGACCATCATTGATGGTTTCCCAGGTGTTCCAAACAAGGTGCAAGCAGTCTTCCAGTCAAATGGAATGCTCTATTTCTTCAATGGCAATCGACAGTACGAATTCAGCATAACGAACAAGAGAGTCTTGCGCCTGCTAAAGCACACCAGTTGGTTGAACTGCTAGACA
Full Trace Sequence: GGGATCATAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGTCCTGGATTCTTTTGCTGAATTCGTACTGTCGATTGCCATTGAAGAAAAATTGCAAATGGATAAAGACTCTCCTCGGACCATCATTGATGGTTTCCCAGGTGTTCCAAACAAGGTGCAAGCAGTCTTCCAGTCAAATGGAATGCTCTATTTCTTCAATGGCAATCGACAGTACGAATTCAGCATAACGAACAAGAGAGTCTTGCGCCTGCTAAAGCACACCAGTTGGTTGAACTGCTAGACAACTTTCTTGTACAAAGTTGGCAAAATAAAAAAAAATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTACCGCCCAGAGCGAAAGACTGGCCAAAGAGTAGAAGAACAAGAAGAAAGAGGAATCCAGGGAGCTCTTNNCCAAAGAAAACGATACAAAAATTTTATCAAAAAAAACGGAAAAGAAAAGAAAAAAAAAAACGAAAAAGGCTATACCAAACCCAGGTTGCCGGGGGGTCACTCATTGTTTTAAAGGAAAAAGGCCCCCCAACCCAATGAACATAAGCCCGGTAGGGTAGAAAAACCTTAATGAAAATAAAGAAAAAAACCCCCCCCACCTGGCCCCAAAAAAATAAAAAAAAAACAACGGGGGGGAACGGCGCACAGGGGGGGTTTTAAGGAATAATTTAATAAAAAATTTTTATTGGGGGAGAAAAAAACCCCCCCGGCAGATCCTAAACAAAACAAAGGCTTGTATAACCAAAAGGGTTAGTTTTTGTTTTGTGGCTTTTACAAACCAACACCCCCCACCCCCCCCCCCCACACAAACCTAAACAAACACCACCACAACAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGTCCTGGATTCTTTTGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ840035
dbEST ID: 79657737
Trimmed Sequence: GCAGTTCAACCAACTGGTGTGCTTTAGCAGGCGCAAGACTCTCTTCTTCGTTATGCTGAATTCGTACTGTCGATTGCCATTGAAGAAATAGAGCATTCCATTTGACTGGAAGACAGCTTGCACCTTGTTTGGAACACCTGGGAAACCGTTACCGAGGGTCCGAGGATAGTCGTTATCCATTTCCCCTTTTATTCAGGGGCGATCAACCATACGAATTCAGCAGAATAAGTCAAGACTACATGGTGCCAATCTCTATGTCCTGGGTAGGCGTCATGGTAAAACGTTCTCTTGACGTTTGGTGCTACGAACAGGTCACCACCAGTCGCAGTAAGGTGCCTATACGCGATCACACTGANTCTCTCGACAGAAAAAAAGATGAAAGCATTACAGAAAGAGAACGCAAAAGCGCGGCGACAGAAAAGAGACAAGAACACTGCGACAACGGAGCCTGCGTGATAGTTGCCGTGTAGGCAGAAAGGGGCCCTAGCCTAGTGGAAAGTCGCCTGGGCGGGGAGTAAGCTGCTAAGGAGAAAAAAAACGGGCGGGGCGAACTGGGTCAGGAACCTTGGGCGAAAGCACCGCGGGAAGGGGGAGGGGGCCGGTTATATTTGGCTTGGAATAACTGTTATTTGACTGCACCTTTCGTGTCGCCGNGCGTCCGGGCACCAACNCCAGTTTTCTGATGGGGTAGAGTTGTTGTCGTTGTGTGTANAGGGAAGGGGAGTTGGAAAAAAAAG
Full Trace Sequence: GAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAANAAAGTTGGCAAGCAGTTCAACCAACTGGTGTGCTTTAGCAGGCGCAAGACTCTCTTCTTCGTTATGCTGAATTCGTACTGTCGATTGCCATTGAAGAAATAGAGCATTCCATTTGACTGGAAGACAGCTTGCACCTTGTTTGGAACACCTGGGAAACCGTTACCGAGGGTCCGAGGATAGTCGTTATCCATTTCCCCTTTTATTCAGGGGCGATCAACCATACGAATTCAGCAGAATAAGTCAAGACTACATGGTGCCAATCTCTATGTCCTGGGTAGGCGTCATGGTAAAACGTTCTCTTGACGTTTGGTGCTACGAACAGGTCACCACCAGTCGCAGTAAGGTGCCTATACGCGATCACACTGANTCTCTCGACAGAAAAAAAGATGAAAGCATTACAGAAAGAGAACGCAAAAGCGCGGCGACAGAAAAGAGACAAGAACACTGCGACAACGGAGCCTGCGTGATAGTTGCCGTGTAGGCAGAAAGGGGCCCTAGCCTAGTGGAAAGTCGCCTGGGCGGGGAGTAAGCTGCTAAGGAGAAAAAAAACGGGCGGGGCGAACTGGGTCAGGAACCTTGGGCGAAAGCACCGCGGGAAGGGGGAGGGGGCCGGTTATATTTGGCTTGGAATAACTGTTATTTGACTGCACCTTTCGTGTCGCCGNGCGTCCGGGCACCAACNCCAGTTTTCTGATGGGGTAGAGTTGTTGTCGTTGTGTGTANAGGGAAGGGGAGTTGGAAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGTTCAACCAACTGGTGTGCTT