ORFeome > mpzl3 ORF1 – XORFeome v1.0

mpzl3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mpzl3
Gene ID: 6078905
Gene Page ID: 5768598
ORF Xenbase ID: 17284677

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC041735
Original XGC clone length: 690

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ823640
dbEST ID: 79641342
Trimmed Sequence: ATGTGGGTACTAATCCTACTGCTAGCGGGCATGCCTCCAGTTCTGTGTATAGATATCAGCATGCATCCCGATGCTTTTGGTGTGGTTGGAAAATCCATTAAGCTTAAGTGCAGCTTCACCTCCTCATACCCAATTTCTGATATAGTTGCTGTGGACTGGACTTATCGCCAGCTAAATGGAGGTTCCACAGTAACGATATTACACTTCCAGAACAAACCATACCCCATTTTGGAAGGTCCTTTCAAAGATCGTATAATTTGGGAGGGAGATGTGAGACGGGGAGATGCCTCTATTTCATTGACAGACTTAAGACTCACAGACAATGGGACTTTGTCATGTATTGTGTGGAACCCACCTGATGTGCATGGAAATGTTCCTCAGACCAAGCTTACCGTCACCATAGAAAATCTCTTCTTCCAGTTCAATACAGTTATCCTGCTTTCAGCTCTAGTATTCATCCCCTCAGCCTTGGTGTCTCTGCTGCTCCTAATCAGGATGAGAAGATCAATCAATAGGGGTAGGACAAAGAACCTGAAATGGAGGAAGAAGTCACCTATTGAAGAGTCACAAGATTGTGTTTATGATGATAATGAAAATACGCCACTGCACCCCACATTACCCCAAGAGCAGTCCCCTGGATGCTTTATGAAGTTTTGCCTTCGATGCCTTGACGATTCTGATGAAGACTT
Full Trace Sequence: ACTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGGTACTAATCCTACTGCTAGCGGGCATGCCTCCAGTTCTGTGTATAGATATCAGCATGCATCCCGATGCTTTTGGTGTGGTTGGAAAATCCATTAAGCTTAAGTGCAGCTTCACCTCCTCATACCCAATTTCTGATATAGTTGCTGTGGACTGGACTTATCGCCAGCTAAATGGAGGTTCCACAGTAACGATATTACACTTCCAGAACAAACCATACCCCATTTTGGAAGGTCCTTTCAAAGATCGTATAATTTGGGAGGGAGATGTGAGACGGGGAGATGCCTCTATTTCATTGACAGACTTAAGACTCACAGACAATGGGACTTTGTCATGTATTGTGTGGAACCCACCTGATGTGCATGGAAATGTTCCTCAGACCAAGCTTACCGTCACCATAGAAAATCTCTTCTTCCAGTTCAATACAGTTATCCTGCTTTCAGCTCTAGTATTCATCCCCTCAGCCTTGGTGTCTCTGCTGCTCCTAATCAGGATGAGAAGATCAATCAATAGGGGTAGGACAAAGAACCTGAAATGGAGGAAGAAGTCACCTATTGAAGAGTCACAAGATTGTGTTTATGATGATAATGAAAATACGCCACTGCACCCCACATTACCCCAAGAGCAGTCCCCTGGATGCTTTATGAAGTTTTGCCTTCGATGCCTTGACGATTCTGATGAAGACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCATTTNGCTGCAACGACCAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCCATCCGGCTGAAATCCCCCTAATGGTGGATCCAAATTAACATGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGGTACTAATCCTACTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ828946
dbEST ID: 79646648
Trimmed Sequence: GTCTTCATCAGAATCGTCAAGGCATCGAAGGCAAAACTTCATAAAGCATCCAGGGGACTGCTCTTGGGGTAATGTGGGGTGCAGTGGCGTATTTTCATTATCATCATAAACACAATCTTGTGACTCTTCAATAGGTGACTTCTTCCTCCATTTCAGGTTCTTTGTCCTACCCCTATTGATTGATCTTCTCATCCTGATTAGGAGCAGCAGAGACACCAAGGCTGAGGGGATGAATACTAGAGCTGAAAGCAGGATAACTGTATTGAACTGGAAGAAGAGATTTTCTATGGTGACGGTAAGCTTGGTCTGAGGAACATTTCCATGCACATCAGGTGGGTTCCACACAATACATGACAAAGTCCCATTGTCTGTGAGTCTTAAGTCTGTCAATGAAATAGAGGCATCTCCCCGTCTCACATCTCCCTCCCAAATTATACGATCTTTGAAAGGACCTTCCAAAATGGGGTATGGTTTGTTCTGGAAGTGTAATATCGTTACTGTGGAACCTCCATTTAGCTGGCGATAAGTCCAGTCCACAGCAACTATATCACATATTGGGTATGAGGAGGTGAAGCTGCACTTAAGCTTAATGGATTTTCAACCACACCAAAAGCATCGGGATGCATGCTGATATCTATACACACAACTGGAGGGCTGCCCGCCTGCAATAAGATTAGTACCCACATTGGTGGCGACTTTTTTTGTACCAAATTTGGTCTTTAAAAAAAACCAATTGGCTCAATCAATTGTATTTGCAAACCGAACAAGGGCACTAAAA
Full Trace Sequence: CCTGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCTTCATCAGAATCGTCAAGGCATCGAAGGCAAAACTTCATAAAGCATCCAGGGGACTGCTCTTGGGGTAATGTGGGGTGCAGTGGCGTATTTTCATTATCATCATAAACACAATCTTGTGACTCTTCAATAGGTGACTTCTTCCTCCATTTCAGGTTCTTTGTCCTACCCCTATTGATTGATCTTCTCATCCTGATTAGGAGCAGCAGAGACACCAAGGCTGAGGGGATGAATACTAGAGCTGAAAGCAGGATAACTGTATTGAACTGGAAGAAGAGATTTTCTATGGTGACGGTAAGCTTGGTCTGAGGAACATTTCCATGCACATCAGGTGGGTTCCACACAATACATGACAAAGTCCCATTGTCTGTGAGTCTTAAGTCTGTCAATGAAATAGAGGCATCTCCCCGTCTCACATCTCCCTCCCAAATTATACGATCTTTGAAAGGACCTTCCAAAATGGGGTATGGTTTGTTCTGGAAGTGTAATATCGTTACTGTGGAACCTCCATTTAGCTGGCGATAAGTCCAGTCCACAGCAACTATATCACATATTGGGTATGAGGAGGTGAAGCTGCACTTAAGCTTAATGGATTTTCAACCACACCAAAAGCATCGGGATGCATGCTGATATCTATACACACAACTGGAGGGCTGCCCGCCTGCAATAAGATTAGTACCCACATTGGTGGCGACTTTTTTTGTACCAAATTTGGTCTTTAAAAAAAACCAATTGGCTCAATCAATTGTATTTGCAAACCGAACAAGGGCACTAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTTCATCAGAATCGTCAAGGCA