ORFeome > mthfr ORF1 – XORFeome v1.0

mthfr ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mthfr
Gene ID: 1005406
Gene Page ID: 1005401
ORF Xenbase ID: 17285073

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC046708
Original XGC clone length: 1932

Human orthology & disease relationships

NCBI Entrez ID: 4524
Ensembl gene IDs: ENSG00000177000,LRG_726
Directly associated (OMIM) disease MIM numbers: 181500,188050,236250,601634
Indirectly associated (Lage, et al.) disease MIM numbers: 229100,236250,250940,259900,600794,601472,605899,606664,608688

Library Location

Plate ID: GDExl11014
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ824155
dbEST ID: 79641857
Trimmed Sequence: ATGGTGAATGCAAACAGCAGTGATAGTGGCACCGCTAGCTGTAGCAGTGCAGAAAACTCCAAGGAAAGCTCCCGATGTTCCACACCAGTCCTGGACATAGAGCGACATGAATGTCTCAAGGAAAAGATGAGAAGGCGGGTTGAAGCTGGCGATAGATGGTTCTCATTGGAGTTTTTTCCTCCACGTACAGCAAGTGGAGCAGTTAACTTGATCTCCAGGTTTGATCGAATGGGTTCAGGAGGTCCCCTCTTCATTGATGTGACCTGGCACCCTGCTGGAGATCCCGGCTCAGATAAAGAGACATCCTCCATGATTATTGCAAGTACTGCTGTTAATTTCTGTGGGTTAGAGACTCTTTTGCATATGACATGCTGCAATCAGACGAAGGAGGACATTACAAAGCATCTCCAAAAGGCAAAGCGTCTTGGGCTGAAGAACATAATGGCTCTTAGAGGAGACCCTACTGGTGAGGAATGGGAGGAAGAGGCAGAGGGCTTTAATTATGCTGTTGATCTTGTTAAGCACATTCGTCATGAATTTGAGGATTACTTTGATATATGTGTTGCCGGATATCCCAGAGGACACCCTGATGCAGAAAGCTATGACCAGGACTTGAAGCACCTTAAGGAGAAAATAGATGCTGGAGCAGATTTTATTATCACTCAGCTTTTCTTTCGATCTGAGACATTCCTACATTTTTAAAAGGATGTAGAGCTATAGGGGATAACGGGTTCTGTCCTGGCCGGGAATCTTCCGATCCAGGGAATTGGGTCTTTGGTCCGCTAATAAATTTTAAAAATTGAGTCCCCCCGGAAATATGGGAGGTTAAAAACAATAAAAGAA
Full Trace Sequence: TAATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAATGCAAACAGCAGTGATAGTGGCACCGCTAGCTGTAGCAGTGCAGAAAACTCCAAGGAAAGCTCCCGATGTTCCACACCAGTCCTGGACATAGAGCGACATGAATGTCTCAAGGAAAAGATGAGAAGGCGGGTTGAAGCTGGCGATAGATGGTTCTCATTGGAGTTTTTTCCTCCACGTACAGCAAGTGGAGCAGTTAACTTGATCTCCAGGTTTGATCGAATGGGTTCAGGAGGTCCCCTCTTCATTGATGTGACCTGGCACCCTGCTGGAGATCCCGGCTCAGATAAAGAGACATCCTCCATGATTATTGCAAGTACTGCTGTTAATTTCTGTGGGTTAGAGACTCTTTTGCATATGACATGCTGCAATCAGACGAAGGAGGACATTACAAAGCATCTCCAAAAGGCAAAGCGTCTTGGGCTGAAGAACATAATGGCTCTTAGAGGAGACCCTACTGGTGAGGAATGGGAGGAAGAGGCAGAGGGCTTTAATTATGCTGTTGATCTTGTTAAGCACATTCGTCATGAATTTGAGGATTACTTTGATATATGTGTTGCCGGATATCCCAGAGGACACCCTGATGCAGAAAGCTATGACCAGGACTTGAAGCACCTTAAGGAGAAAATAGATGCTGGAGCAGATTTTATTATCACTCAGCTTTTCTTTCGATCTGAGACATTCCTACATTTTTAAAAGGATGTAGAGCTATAGGGGATAACGGGTTCTGTCCTGGCCGGGAATCTTCCGATCCAGGGAATTGGGTCTTTGGTCCGCTAATAAATTTTAAAAATTGAGTCCCCCCGGAAATATGGGAGGTTAAAAACAATAAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAATGCAAACAGCAGTGA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CCCCCCTAGCGCTAGCCCGTGTCTATAATCTCTGATGTCCAGAATAGGGGATAGCCGCTGGGTGGGAGATAAAGATTTTATTTTGAGTCAGAGCGACCTGTTCGTCGCCACAAAATGACAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGACAGATGGTCTATCATGCTCTTTAAAGGTCTCCTCCATAACCTGCCACAAGCAATTCTCAAGGGGGCAATCATTATCCACCAAAGTTACCGAGTGGTAGGGTGTCATGGATACTCAGAAGAATCATACGGGCCGGAGACTCCACTTGAAACAGTTTGAGCCACTTCTCAATCCACAAGGCAAAGGGCAGGGCCCTCCCCTCCCCAAAGATGACCGGGGCCACCACCGCTGGGTTTCGTGTTTTGGCCGCCCTGGAAAGACTGCCCCCCGGCCCCACCATCCCGGTGGTAAGTCTTCGGCTGTTGGAGAGTTTTTTTTCCTTTTGTTTTGCTCTTATGTACAAATTCAACGGGGGGGATTAAGAATGCTTTAGCCACTATGGGAGGGGGCTTCGGGCGTTGGTCCCCCGGGATGCTCTTCTTTACAAAAACCCCCCCTTCTGGAAGGAATGAGGAACGAGGGGTTGGGCGCCGGACCAAAAATGGGGTTTGTAGTGGGGTGTCGCCCCGTTGCGCTTGTGGGTGGGGGGGGTGGGTGTGGGGGGTATTCGCCTGGTTTTGGTATGTTTTGTGTGGGGACCCCCTGCTGTGAAGAAGGGTGGGAGGGGGGGGGGCTGTAGGGGGGCCCGTGGGGGGGGAAGAGGAGGGGGCGGGTGAAGGGGGAGGGTCCGCGTTTAAGCGCTCAGGGTGCTTCTCGCGGTGGGGGGTGGGGGGGGGGAGGACGGGGGTCTGCGATTAAACAGAAATGGTGCTTGCTTGCGGCCGCGCGTTGTGGGTTGTGATTGTTATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGTCAGTTGGTCTATC