ORFeome > mxd3 ORF1 – XORFeome v1.0

mxd3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mxd3
Gene ID: 867580
Gene Page ID: 867570
ORF Xenbase ID: 17285187

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127416
Original XGC clone length: 603

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ837303
dbEST ID: 79655005
Trimmed Sequence: ATGGAACAGCTCCCCAGCAATCTGCAGGTTCTTCTGCAAGCTGCTGAGTACGTGGAGCGAAGGGAAAGAGAAGCAGAGCATGGTTATGCCTCCATCTTGCCTTGTGATCCTGCCACCCCTGGGAGGCGAAAACGTCAGAGAACAAACAGCAACCCAGATAATGTCAGATCTGTTCACAATGAGCTAGAGAAACACAGGCGAGCTCAACTTCGAAGATGCTTAGAGCAGCTTAAACAACAAGTGCCTTTGAGCATGGAAAACTCAAGGCATACAACGCTCAGTCTACTACACAGGGCCAAGCAACACATCAAAAAACTGGAAGACCAGGAGCTAAGGGCAAAAAGTTTGAAGGAAAAACTGAGGGCTGATCAGCAGAAGCTCCGCCAGAGACTAAAACGGCTTTTACCTCCTAACACTGAGCGGATTCGAACTGACAGCTTAGATTCGTCAAATTTATCCTCGGAGAGGTCTGATTCAGATCAAGAGGATTTGGAGGTAGATGTGGAGGGAATAATTCTGAGCGGCAATGAGGGTGAACTCTTTGTTTCATTTAGTGCTGGGCTGGAACACAGCTACTCTACTCCAGCTCATGCCTGGCTATT
Full Trace Sequence: TCGCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACAGCTCCCCAGCAATCTGCAGGTTCTTCTGCAAGCTGCTGAGTACGTGGAGCGAAGGGAAAGAGAAGCAGAGCATGGTTATGCCTCCATCTTGCCTTGTGATCCTGCCACCCCTGGGAGGCGAAAACGTCAGAGAACAAACAGCAACCCAGATAATGTCAGATCTGTTCACAATGAGCTAGAGAAACACAGGCGAGCTCAACTTCGAAGATGCTTAGAGCAGCTTAAACAACAAGTGCCTTTGAGCATGGAAAACTCAAGGCATACAACGCTCAGTCTACTACACAGGGCCAAGCAACACATCAAAAAACTGGAAGACCAGGAGCTAAGGGCAAAAAGTTTGAAGGAAAAACTGAGGGCTGATCAGCAGAAGCTCCGCCAGAGACTAAAACGGCTTTTACCTCCTAACACTGAGCGGATTCGAACTGACAGCTTAGATTCGTCAAATTTATCCTCGGAGAGGTCTGATTCAGATCAAGAGGATTTGGAGGTAGATGTGGAGGGAATAATTCTGAGCGGCAATGAGGGTGAACTCTTTGTTTCATTTAGTGCTGGGCTGGAACACAGCTACTCTACTCCAGCTCATGCCTGGCTATTGCCAACTTTCTTGGACCAATTGGCATTATAAGAAAGCATTGCTTATCAATTTGTGCAACGAACAGGTCACTATCAATTCAAATAAAATCATTAATTTGCATCCAGCCTTAATAACCACAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAATAACTTAATTACCAGGGAAACCTTCTGGGCCCGGGGTCAAAAAAAAATGTCTTCTAATAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACAGCTCCCCAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837302
dbEST ID: 79655004
Trimmed Sequence: TAGCCAGGCATGAGCTGGAGTAGAGTAGCTGTGTTCCAGCCCAGCACTAAATGAAACAAAGAGTTCACCCTCATTGCCGCTCAGAATTATTCCCTCCACATCTACCTCCAAATCCTCTTGATCTGAATCAGACCTCTCCGAGGATAAATTTGACGAATCTAAGCTGTCAGTTCGAATCCGCTCAGTGTTAGGAGGTAAAAGCCGTTTTAGTCTCTGGCGGAGCTTCTGCTGATCAGCCCTCAGTTTTTCCTTCAAACTTTTTGCCCTTAGCTCCTGGTCTTCCAGTTTTTTGATGTGTTGCTTGGCCCTGTGTAGTAGACTGAGCGTTGTATGCCTTGAGTTTTCCATGCTCAAAGGCACTTGTTGTTTAAGCTGCTCTAAGCATCTTCGAAGTTGAGCTCGCCTGTGTTTCTCTAGCTCATTGTGAGCAAATCTAACATTATCTGGGGGTGCTGTTTGTGCTCTGACGTTTTCGCCTCCCAGGGGGGGCAGGATCACAAAGCAAGATGGAAAGCGGAGCATGCTCGGCTTGTCTTTCCTTTCCCTCCACAACGTAGCAGCTTGCGGAGAGGCAACAGAATGCTGGGGGGGCGGTTCTATGTTGCGACTTGTTCTTTCCAGGTTGGGCGGTGTAAAAAGACAATACTCCGCGATTTGTTGCCAACAAAAAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: GGCATTCGGCTACTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGCCAGGCATGAGCTGGAGTAGAGTAGCTGTGTTCCAGCCCAGCACTAAATGAAACAAAGAGTTCACCCTCATTGCCGCTCAGAATTATTCCCTCCACATCTACCTCCAAATCCTCTTGATCTGAATCAGACCTCTCCGAGGATAAATTTGACGAATCTAAGCTGTCAGTTCGAATCCGCTCAGTGTTAGGAGGTAAAAGCCGTTTTAGTCTCTGGCGGAGCTTCTGCTGATCAGCCCTCAGTTTTTCCTTCAAACTTTTTGCCCTTAGCTCCTGGTCTTCCAGTTTTTTGATGTGTTGCTTGGCCCTGTGTAGTAGACTGAGCGTTGTATGCCTTGAGTTTTCCATGCTCAAAGGCACTTGTTGTTTAAGCTGCTCTAAGCATCTTCGAAGTTGAGCTCGCCTGTGTTTCTCTAGCTCATTGTGAGCAAATCTAACATTATCTGGGGGTGCTGTTTGTGCTCTGACGTTTTCGCCTCCCAGGGGGGGCAGGATCACAAAGCAAGATGGAAAGCGGAGCATGCTCGGCTTGTCTTTCCTTTCCCTCCACAACGTAGCAGCTTGCGGAGAGGCAACAGAATGCTGGGGGGGCGGTTCTATGTTGCGACTTGTTCTTTCCAGGTTGGGCGGTGTAAAAAGACAATACTCCGCGATTTGTTGCCAACAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGCCAGGCATGAGCTGGA