ORFeome > nexn ORF1 – XORFeome v1.0

nexn ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nexn
Gene ID: 866227
Gene Page ID: 493146
ORF Xenbase ID: 17286171

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124932
Original XGC clone length: 2031

Human orthology & disease relationships

NCBI Entrez ID: 91624
Ensembl gene IDs: ENSG00000162614
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,104300,105120,108120,115200,123500,125853,131950,145980,151660,159001,176670,181350,182290,184500,211980,215600,226650,226670,245050,248370,600652,603278,604219,604929,605588,606054,606595,607841,607920,608056,609015,609285

Library Location

Plate ID: GDExl11083
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ837294
dbEST ID: 79654996
Trimmed Sequence: ATGAATGACGTGGCTCAAAAGACAGAGATGAAAGAACTGCTTGCTTCTGATGATGAAGAGGAAAATAAGCCAATACAAATAGAAAAGGGTTATGTCCCAAAACTAACAGGAACAGTAAAAGGAAAATTTGCTGAAATGGAAAAACAGAGACATGAAGAAGAAAGAAAAAGACGGGAGGAGGAAAGGAAAAGGAGACTGGAGCAGGATCAGAAGGAAAGACGTAAGATAGAACGTGAGCTGGCAAAGAAAGCAGAAGAGATTGATGACATAAACTTTACTGGAAGTGACTCGGACATGGAGGAAGGTGTTGAGGAAGTAGCTGTACCAGACATAACAAATAAGTCAAAAATATCACCAGGGAAAATAAATGTCAATTTTGAAGATCTAGAAAAGAAAAGGGAAGAAGAAGAAAAGAAAAACCGCGAAGAAGACAAAAAAAGACGATATGAAGAGCATAGAAGGTCATTCAGGGAAGCTAACAGGCGTCCCTCAACTATGGATGACTCTGAAACTCAAGATAAGATAACCAAAGAGCACATAACACCTGGCAAGCTAGGTTAACTTTTGAAAAGCTGAAAAGCAAAGACAAGAACAACAAAAAAAACAAGCCGAAAAAGAATACGCCTCCGCTTTACAAAATAAAAAGCGGCGGGGTGGGGAGTCAAAACAACAAAATCCTTAATTGAGAAAGGAGGGGGGATAGGGGGGGTGGGGGGGTGGGTAAGGAAAAAATCCCGATTCATGGAATGATTTGGAATTT
Full Trace Sequence: GGCCCACAATAATTGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATGACGTGGCTCAAAAGACAGAGATGAAAGAACTGCTTGCTTCTGATGATGAAGAGGAAAATAAGCCAATACAAATAGAAAAGGGTTATGTCCCAAAACTAACAGGAACAGTAAAAGGAAAATTTGCTGAAATGGAAAAACAGAGACATGAAGAAGAAAGAAAAAGACGGGAGGAGGAAAGGAAAAGGAGACTGGAGCAGGATCAGAAGGAAAGACGTAAGATAGAACGTGAGCTGGCAAAGAAAGCAGAAGAGATTGATGACATAAACTTTACTGGAAGTGACTCGGACATGGAGGAAGGTGTTGAGGAAGTAGCTGTACCAGACATAACAAATAAGTCAAAAATATCACCAGGGAAAATAAATGTCAATTTTGAAGATCTAGAAAAGAAAAGGGAAGAAGAAGAAAAGAAAAACCGCGAAGAAGACAAAAAAAGACGATATGAAGAGCATAGAAGGTCATTCAGGGAAGCTAACAGGCGTCCCTCAACTATGGATGACTCTGAAACTCAAGATAAGATAACCAAAGAGCACATAACACCTGGCAAGCTAGGTTAACTTTTGAAAAGCTGAAAAGCAAAGACAAGAACAACAAAAAAAACAAGCCGAAAAAGAATACGCCTCCGCTTTACAAAATAAAAAGCGGCGGGGTGGGGAGTCAAAACAACAAAATCCTTAATTGAGAAAGGAGGGGGGATAGGGGGGGTGGGGGGGTGGGTAAGGAAAAAATCCCGATTCATGGAATGATTTGGAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGACGTGGCTCAAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837293
dbEST ID: 79654995
Trimmed Sequence: ATAGTCATCAGTTTCAACGCTGAGAATACAGCTGCTAGCTGCTGTCCCTCTGCTGTTTACTGCTTTACACATGTATTCCCCATCATCCTCTGGAAATGTCTCGGGAAGATAAAGACAGTAGGTGTCTCCTCTTTCAATATATTGATAGTCTTCACAGTCCTGTAGCATTTCACCTTCAAACCACCATGTAACTGTGGCTTTTGGCTCACCAGTGACCTTAACAGTAAACCTTACTGGTTCTCCATCAACAACTGACATATTTTTAAGTGGTTTCTTAAACCAGGGTGCCCCAGACCGAGCAAGCTCTTCATCTTCATTTTGTGATCCATTGGCACTTACTTCCTCCTCCTCTTCTTCTTTTGTCTTTTGTAAGGCTGCATCAATCTCTTTCTGTTCAAACTGCATCCGCTGACGTTTTTGTTCTTCAATTCTCCTTAGCTCTTCTTCCTCTCTGGCTCTTGCCATTTGTTCAAATCTAGCCTTCATGTTAACTTTGTGGGAGAATGGTGCACGACTCTTGATAGTTGGTCTGACATCAACATCTTCATCCTCATGAAAATGCTCTGCCTCTCTCCTCTTTCGCTCCTGGTCCATGGCTTGTCGTCTAGACCCTTTCCCCTTCAATCTTCCCTTGGTATTT
Full Trace Sequence: GGGGAAACGTCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAGTCATCAGTTTCAACGCTGAGAATACAGCTGCTAGCTGCTGTCCCTCTGCTGTTTACTGCTTTACACATGTATTCCCCATCATCCTCTGGAAATGTCTCGGGAAGATAAAGACAGTAGGTGTCTCCTCTTTCAATATATTGATAGTCTTCACAGTCCTGTAGCATTTCACCTTCAAACCACCATGTAACTGTGGCTTTTGGCTCACCAGTGACCTTAACAGTAAACCTTACTGGTTCTCCATCAACAACTGACATATTTTTAAGTGGTTTCTTAAACCAGGGTGCCCCAGACCGAGCAAGCTCTTCATCTTCATTTTGTGATCCATTGGCACTTACTTCCTCCTCCTCTTCTTCTTTTGTCTTTTGTAAGGCTGCATCAATCTCTTTCTGTTCAAACTGCATCCGCTGACGTTTTTGTTCTTCAATTCTCCTTAGCTCTTCTTCCTCTCTGGCTCTTGCCATTTGTTCAAATCTAGCCTTCATGTTAACTTTGTGGGAGAATGGTGCACGACTCTTGATAGTTGGTCTGACATCAACATCTTCATCCTCATGAAAATGCTCTGCCTCTCTCCTCTTTCGCTCCTGGTCCATGGCTTGTCGTCTAGACCCTTTCCCCTTCAATCTTCCCTTGGTATTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAGTCATCAGTTTCAACGCTGAG