ORFeome > nif ORF1 – XORFeome v1.0

nif ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nif
Gene ID: 876576
Gene Page ID: 876556
ORF Xenbase ID: 17286297

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043782
Original XGC clone length: 1410

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ823881
dbEST ID: 79641583
Trimmed Sequence: ATGACTTCCAGGGAGCTCTACACTTCGTCCTACAAGAAGATCTTTGGGGATTCCCCTAGGTCCTCCAGCCTCCTGTATACCACCAACAGTAGCAGCAGCAGGTCCCAGTCGTACAGACCCAGGGAAGCCTACACCAGCAACATCTCCTCCTACAGGAAGGTCAGTCGCTCCCCAGGACACCTGAGCTCAGCCCAGGACCACTTTGACCTTTCTCAGTCCACTGCCCTGAGCAATGAGCTGAAGATTGTCAGGACCAACGAGAAGGAGCAGCTGCAGGGTCTCAATGACCGCTTTGTCACCTACATTGAGAAGGTTCATCACCTGGAGCAGCAGAACAAGCTGTTGGAGAGCGAGGTGACCTTGCTGAGGCAAAAGCACTCAGAGCCTTCCCGGCTGAGCCATATCTATGAGCAGGAGATCCGGGAGCTGAGGTCCAAGCTGGAGGAGCAGGAGCAGGACAAGGACCAAGCGCAGTTGGACTACGAGCACTTGGGGGCATGTCTGGAGCAGCTCAAGCTCAAACTGGAGCAGGAGTCCGCCAGGAGGGAGGAGGCAGAGGATGTCATGAAGAACTATAGGAAGGACTTGGACCAAGCCACCCTCAACCGCTTGCAACTGGAGAAGAAGGTGGAGTCGCTGCTGGACGAGATCGCTTCCCTGAGGAAGTCCATGAAGGAGGAGATTGCTGAGCTTCANGCTTCCGTGCAGGAAGCGCAGACTCTGTGGAAAAGGGATGTGGGTAAGCAAACCGCACTTGACGGCTGGCCTGAAGGAATCCCAGGGCGAATAAAAGGTCTTTCTCCCGCCATCACCTTCCTCCCCCAAGAAGGGGGTTGG
Full Trace Sequence: AAATATTGATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTTCCAGGGAGCTCTACACTTCGTCCTACAAGAAGATCTTTGGGGATTCCCCTAGGTCCTCCAGCCTCCTGTATACCACCAACAGTAGCAGCAGCAGGTCCCAGTCGTACAGACCCAGGGAAGCCTACACCAGCAACATCTCCTCCTACAGGAAGGTCAGTCGCTCCCCAGGACACCTGAGCTCAGCCCAGGACCACTTTGACCTTTCTCAGTCCACTGCCCTGAGCAATGAGCTGAAGATTGTCAGGACCAACGAGAAGGAGCAGCTGCAGGGTCTCAATGACCGCTTTGTCACCTACATTGAGAAGGTTCATCACCTGGAGCAGCAGAACAAGCTGTTGGAGAGCGAGGTGACCTTGCTGAGGCAAAAGCACTCAGAGCCTTCCCGGCTGAGCCATATCTATGAGCAGGAGATCCGGGAGCTGAGGTCCAAGCTGGAGGAGCAGGAGCAGGACAAGGACCAAGCGCAGTTGGACTACGAGCACTTGGGGGCATGTCTGGAGCAGCTCAAGCTCAAACTGGAGCAGGAGTCCGCCAGGAGGGAGGAGGCAGAGGATGTCATGAAGAACTATAGGAAGGACTTGGACCAAGCCACCCTCAACCGCTTGCAACTGGAGAAGAAGGTGGAGTCGCTGCTGGACGAGATCGCTTCCCTGAGGAAGTCCATGAAGGAGGAGATTGCTGAGCTTCANGCTTCCGTGCAGGAAGCGCAGACTCTGTGGAAAAGGGATGTGGGTAAGCAAACCGCACTTGACGGCTGGCCTGAAGGAATCCCAGGGCGAATAAAAGGTCTTTCTCCCGCCATCACCTTCCTCCCCCAAGAAGGGGGTTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCCAGGGAGCTCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ829190
dbEST ID: 79646892
Trimmed Sequence: GTTTGCTGCAGCTTTTTGAGAGATCTTTTCTTGATCCCCTGGCTTTGAGGTTTTGGGTTGGCCAGAGCTGCCTCCTCTCCCACCCTCTGGTGACTCTTTCTTCTCCTCTTTCCTGATACTGATGGTGCTTGTGGTGGAGCTTCTGCCGCCGGAGTATGACCCAGAGGAGAATGGGTAGCCAATACCGAACATGCTGCCTCCGCCCACTGAGGTTAGACGTGTCTCCTCCCCTTCTAGAAGTTTCCTGTAAGCAGCTATTTCAATATCCAAAGCCATCTTGACATTGAGGAGATCCTGGTACTCCCTCAGATGTCGTGCCATCTCTTCCTTTGTGGTCCTCAAAGCATTGTCAAGCTGGCCGATGGTATCCTGCAGATGAGACATTTCTTCATTACTCCTATCCTCGGCTTCCTGCAGCTGCCTCTCTAGGGACTCGTTGGCACTGCGCAGAGCATCAATCTCCAATGTTCGTGCCTGGAGCTGCCGGCGGTACTCTGTGATCTCCTCTTTGGCCTGACGGACAGAGTCGTTATTACGGGAAGCTTCCAGAGATACGTTGGCAATCTTGGCCTGGTACCCCTCCTCGGATGACTGCTGATTGGCGGGCAGACGGAACCTCCTACTGCAGGCGGATTTTCTTTCATTGCCACCCTTCCGATCGGGCCTTGCTAACCACATCCATCCTCCACAAAAAACTGCCCCCTCCGGGCACGGAAAACCGGGAACCCTCAG
Full Trace Sequence: CCGGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGAGTATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTGCTGCAGCTTTTTGAGAGATCTTTTCTTGATCCCCTGGCTTTGAGGTTTTGGGTTGGCCAGAGCTGCCTCCTCTCCCACCCTCTGGTGACTCTTTCTTCTCCTCTTTCCTGATACTGATGGTGCTTGTGGTGGAGCTTCTGCCGCCGGAGTATGACCCAGAGGAGAATGGGTAGCCAATACCGAACATGCTGCCTCCGCCCACTGAGGTTAGACGTGTCTCCTCCCCTTCTAGAAGTTTCCTGTAAGCAGCTATTTCAATATCCAAAGCCATCTTGACATTGAGGAGATCCTGGTACTCCCTCAGATGTCGTGCCATCTCTTCCTTTGTGGTCCTCAAAGCATTGTCAAGCTGGCCGATGGTATCCTGCAGATGAGACATTTCTTCATTACTCCTATCCTCGGCTTCCTGCAGCTGCCTCTCTAGGGACTCGTTGGCACTGCGCAGAGCATCAATCTCCAATGTTCGTGCCTGGAGCTGCCGGCGGTACTCTGTGATCTCCTCTTTGGCCTGACGGACAGAGTCGTTATTACGGGAAGCTTCCAGAGATACGTTGGCAATCTTGGCCTGGTACCCCTCCTCGGATGACTGCTGATTGGCGGGCAGACGGAACCTCCTACTGCAGGCGGATTTTCTTTCATTGCCACCCTTCCGATCGGGCCTTGCTAACCACATCCATCCTCCACAAAAAACTGCCCCCTCCGGGCACGGAAAACCGGGAACCCTCAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTGCTGCAGCTTTTTGAGA