ORFeome > nvl ORF1 – XORFeome v1.0

nvl ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nvl
Gene ID: 958004
Gene Page ID: 957999
ORF Xenbase ID: 17287305

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044980
Original XGC clone length: 2565

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ823911
dbEST ID: 79641613
Trimmed Sequence: ATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGACCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCANGAACGGGTCGAAGTCAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGACCGGCTCTTAATGATAAGGNAAAGGGTAAAGTCCCAGAAGTGCAGCATTCTTCTCTGAGGTTTTGAGAATATGGGGGGGAATGAAGATACCCCTAAAGGAGGGGTGGCAAATGATGAAATCCCATGG
Full Trace Sequence: AATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGAATTGTCCGGGATCTCCGGGAATAGACGGGAGGCTCAAGTACCGGCTCACCCAGTATCTGAGCAGTAACAAATGTGGTGGATACGTGGATATCGCTGTAGTAGCTGCTGATCTACAGAAGTTATACAGAGCAGACTATGGCAGGAGAAAACAGAATGCCTTCCGAATACAGGTAGAAAAAGTGTTTAAGGTTATCAGCAGTGAGACTGAGGGCATTGACACCCTGGAAGGGACACACCTGGCAAAAAGGGCAAAAAGAGGAGACGATGGAAATCTAGAAATTTCATCTGACTCTACGGATAGTGATGACTACGCAGATCAACCTTCTTCAAATCACATGAACAATTCTCTGCTATCCTTGTACCGCAAAGGGAACCTTGACTCCGTATTGGAGACTCCTGTCAAAAATGACCTTCCAGACACCAGCACTCCAGCACATCCTACCAAGAATGCCCGTATGGCAACAGTCGGGACCCCCCAGGGCACTAAGACACCAGAAGCTGGCTGGTTTATTGACAAAACTCCCAGTAAGGCAATGGAGCAAAGCATCCTCATTGATCTGTGCGAGGATGGAGCAGAGGCGTCGGCACAGAATGAGAACCCCCTGGACCTTTCCCTCTTGGAGAGTGAGAAGAAGAGAAAGACCCCAAAGACCANGAACGGGTCGAAGTCAAAAGCAAAGCTAATGATGTCGATGCGGAAATTGAGACCGGCTCTTAATGATAAGGNAAAGGGTAAAGTCCCAGAAGTGCAGCATTCTTCTCTGAGGTTTTGAGAATATGGGGGGGAATGAAGATACCCCTAAAGGAGGGGTGGCAAATGATGAAATCCCATGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGAATTGTCCGGGATCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829220
dbEST ID: 79646922
Trimmed Sequence: TCGGCTGAGTGACTGGCGCAGGAGCTCGTACATCAGCTGATCCTTCTTGGACACTGAGGGTTTCACTTTATTAAAAGCCTCTTCAAAATTCCTTTGGCTCACCTTGATCTGCCCTGGGTTTGTGTGCGGCTCCTGCACCAACATCTCTTGCCTCAGGGCACTTATTGAAGCTTCCCGTACAAGGGCCGAGAGATCAGCACCCGTGAAGCAGTCGCAGCGCACGTCACTAGCAATCGTTTCCAGGTTGACATCGGCTTCCAAGGGCGGGCGGGTTCCATCCTTAGTGATAGTCTTTAATATGGCAAACCGGTCGGCAGGGGGAGGAAGCCCCACGTACAGTGTTTTATCGAGGCGTCCGGGTCGCAGGATGGCTGGGTCAATGATATCTGGCCGGTTTGTTGCTGCCATTATGAATACCTGCCGGCGGCTTTCAAGTCCGTCCATCTCAGTCAGCAGCTGGTTCACTACCCGCACGCTGGCACCTGAATCATGTCCAGATCTACGTGGGCAGAGAGCATCGATCTCATCAAAAAATATCACACAAGGAGAAGAGTTTGTAGCCCTCTGGAAGACTTGTCGGACTGCGCGTTCACTCTCTCCAACGTACATGTTTCACAGCTCTGGCCCCTTTCACGAAATAAAATTGAGTCCAAATTCGTTTTGCACAACCTTTGCCCGTTAAGTTTTTGCCACAGCCCGGGGGGGTCTTGCCCATTAAGAATCCCGCCTGGGTGGCCCCTCGGGGCCAAGGGGGCTT
Full Trace Sequence: GGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCGGCTGAGTGACTGGCGCAGGAGCTCGTACATCAGCTGATCCTTCTTGGACACTGAGGGTTTCACTTTATTAAAAGCCTCTTCAAAATTCCTTTGGCTCACCTTGATCTGCCCTGGGTTTGTGTGCGGCTCCTGCACCAACATCTCTTGCCTCAGGGCACTTATTGAAGCTTCCCGTACAAGGGCCGAGAGATCAGCACCCGTGAAGCAGTCGCAGCGCACGTCACTAGCAATCGTTTCCAGGTTGACATCGGCTTCCAAGGGCGGGCGGGTTCCATCCTTAGTGATAGTCTTTAATATGGCAAACCGGTCGGCAGGGGGAGGAAGCCCCACGTACAGTGTTTTATCGAGGCGTCCGGGTCGCAGGATGGCTGGGTCAATGATATCTGGCCGGTTTGTTGCTGCCATTATGAATACCTGCCGGCGGCTTTCAAGTCCGTCCATCTCAGTCAGCAGCTGGTTCACTACCCGCACGCTGGCACCTGAATCATGTCCAGATCTACGTGGGCAGAGAGCATCGATCTCATCAAAAAATATCACACAAGGAGAAGAGTTTGTAGCCCTCTGGAAGACTTGTCGGACTGCGCGTTCACTCTCTCCAACGTACATGTTTCACAGCTCTGGCCCCTTTCACGAAATAAAATTGAGTCCAAATTCGTTTTGCACAACCTTTGCCCGTTAAGTTTTTGCCACAGCCCGGGGGGGTCTTGCCCATTAAGAATCCCGCCTGGGTGGCCCCTCGGGGCCAAGGGGGCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCGGCTGAGTGACTGGC