ORFeome > nxt2 ORF1 – XORFeome v1.0

nxt2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nxt2
Gene ID: 5823562
Gene Page ID: 5823503
ORF Xenbase ID: 17287347

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC058202
Original XGC clone length: 423

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ824485
dbEST ID: 79642187
Trimmed Sequence: ATGGCTACAACGGATTTTAGGACAGAAGTCGACTTGGCATGCAGGACAGCAGACGAATTTGTCAACCTTTATTATGAGACCATTGATAAGAGGAGACGGCAACTGACCAAGCTGTACATGGACAGCGCTACGTTGGTTTGGAATGGCAATCCAGTCTCAGGCCAAGACTCCCTTATCGAGTTTTTTGAAATGTTGCCATCCAGCGAGTTTCAAGTCAATATGTTTGACTGCCAGCCTGTCCACGAACAAGCTACCCAGGGGCAGAAAACAGTTCTGGTTGTTGCCCATGGAACTGTAAAATTCGAAGGAAATAAGAATCATTATTTCAATCAGAACTTTCTCCTGAGTCTTCATGCGACACCAACCAACAGTGTGTGGAAGATAGCCAGTGATTGTTTCCGCTTCCAGGACTGGGCAAGCTT
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTACAACGGATTTTAGGACAGAAGTCGACTTGGCATGCAGGACAGCAGACGAATTTGTCAACCTTTATTATGAGACCATTGATAAGAGGAGACGGCAACTGACCAAGCTGTACATGGACAGCGCTACGTTGGTTTGGAATGGCAATCCAGTCTCAGGCCAAGACTCCCTTATCGAGTTTTTTGAAATGTTGCCATCCAGCGAGTTTCAAGTCAATATGTTTGACTGCCAGCCTGTCCACGAACAAGCTACCCAGGGGCAGAAAACAGTTCTGGTTGTTGCCCATGGAACTGTAAAATTCGAAGGAAATAAGAATCATTATTTCAATCAGAACTTTCTCCTGAGTCTTCATGCGACACCAACCAACAGTGTGTGGAAGATAGCCAGTGATTGTTTCCGCTTCCAGGACTGGGCAAGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAACACCGGAAAAGATGTAAAAGGGNGCTNGGTGCCTTGTGGGGTGGTCGGCGTGCGCCGCGCCTTTGTGCCCCGGGTTTCCCCGCCGGGGTTGGGTTGCAAAAAAAACTTAATATGAATACGAAACTTTCCACGGGGCAGAGGGGAAAACAATCCGTTCCCCCGGGGCGGGTGCAATAAGTATCCCTGTGGTCACATTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACAACGGATTTTAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829839
dbEST ID: 79647541
Trimmed Sequence: GCTTGCCCAGTCCTGGAAGCGGAAACAATCACTGGCTATCTTCCACACACTGTTGGTTGGTGTCGCATGAAGACTCAGGAGAAAGTTCTGATTGAAATAATGATTCTTATTTCCTTCGAATTTTACAGTTCCATGGGCAACAACCAGAACTGTTTTCTGCCCCTGGGTAGCTTGTTCGTGGACAGGCTGGCAGTCAAACATATTGACTTGAAACTCGCTGGATGGCAACATTTCAAAAAACTCGATAAGGGAGTCTTGGCCTGAGACTGGATTGCCATTCCAAACCAACGTAGCGCTGTCCATGTACAGCTTGGTCAGTTGCCGTCTCCTCTTATCAATGGTCTCATAATAAAGGTTGACAAATTCGTCTGCTGTCCTGCATGCCAAGTCGACTTCTGTCCTAAAATCCGTTGTAGCCATGG
Full Trace Sequence: GGGCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTGCCCAGTCCTGGAAGCGGAAACAATCACTGGCTATCTTCCACACACTGTTGGTTGGTGTCGCATGAAGACTCAGGAGAAAGTTCTGATTGAAATAATGATTCTTATTTCCTTCGAATTTTACAGTTCCATGGGCAACAACCAGAACTGTTTTCTGCCCCTGGGTAGCTTGTTCGTGGACAGGCTGGCAGTCAAACATATTGACTTGAAACTCGCTGGATGGCAACATTTCAAAAAACTCGATAAGGGAGTCTTGGCCTGAGACTGGATTGCCATTCCAAACCAACGTAGCGCTGTCCATGTACAGCTTGGTCAGTTGCCGTCTCCTCTTATCAATGGTCTCATAATAAAGGTTGACAAATTCGTCTGCTGTCCTGCATGCCAAGTCGACTTCTGTCCTAAAATCCGTTGTAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCAAGACTTAAGACTGGCCGTCGTTTACAGCAATTGGTAACTCGGGAAAATTGTATGAATGGCCCGATCAGCAATTCCTAATGGATTTGAAAAGATCAACATAGCAGGTTGAAAATCAAAAAATGGTCCCCCTTTGGTACCCCGTTTTTACAATAAACCCAAACTGAAGACGTTTTTCACTCCGCCTCTGGGAGTGACATCAACAAGGAACAAATTCTCCGGGGCAGGGTTCCTAACCCCAATAAAAATTTCCCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTGCCCAGTCCTGGAA