ORFeome > pccb ORF1 – XORFeome v1.0

pccb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pccb
Gene ID: 993791
Gene Page ID: 993784
ORF Xenbase ID: 17288229

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC061665
Original XGC clone length: 1626

Human orthology & disease relationships

NCBI Entrez ID: 5096
Ensembl gene IDs: ENSG00000114054
Directly associated (OMIM) disease MIM numbers: 606054
Indirectly associated (Lage, et al.) disease MIM numbers: 201450,201460,203750,231530,242100,245050,255120,264470,300000,300194,300387,300438,312170,600649,602398,604387,606054,608836,609015,609975

Library Location

Plate ID: GDExl11022
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ824888
dbEST ID: 79642590
Trimmed Sequence: ATGGCGGCTGTTCGCAGCGTATCCCGGTTTCTGGCCGCTGTCAGGGGGTCCGGCTCGGTGTGTGGTCCCCGGGGGTTACTCCGTGCGTACTCTGTATCTCATCTTTCCGTGCCGGAGCGGATAGAGAAAAAGAGGAGAGAGGCGCTAGTTGGCGGGGGAGAGCAGCGCATAGAGGCTCAGCACAGAAGGGGAAAGTTGACGGCGAGGGAACGGATCAGTCTCCTGTTGGACCCGGGGAGCTTTGCAGAATATGATATGTTTGTGGAGCACCGATGCTCAGATTTTGGGATGGAAGAGGACAGGAATAAGTATCCTGGGGACAGTGTAGTGACGGGACAAGGCCGCATTAATGGGAGGCTAGTTTATGTCTTCAGCCAGGATTTTACTGTTTTTGGGGGCAGTTTATCTGGGGCACATGCTCAAAAGATCTGCAAGATCATGGACCAGGCTGTCATGGTGGGAGCTCCTGTTATTGGACTCAATGACTCAGGAGGGGCTCGTATCCAGGAAGGTGTGGAGTCACTGGCTGGCTATGCTGATATATTCTTGAGGAACGTGCTGAGCTCAGGGGTTGTCCCACAGATTTCCCTGATTATGGGGCCTTGTGCTGGGGGGTGCAGTCTACTCACCAGCATTAACAGAACTTTACATTTATGGTGAAGGATACTTCCTACCTATTCATCACTTGGCCCGATGTAGTAAAGTCCGTTACCAATGAGAATGTGACGCANGAAAAACTTGGGAAGAGCCAAAACCCACATGCCGATGGTCAGGGGGTGCTTCATCCCGGCTTTTGAAAAATGAAATTTAATGCCTTATT
Full Trace Sequence: AAATGATTTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGTTCGCAGCGTATCCCGGTTTCTGGCCGCTGTCAGGGGGTCCGGCTCGGTGTGTGGTCCCCGGGGGTTACTCCGTGCGTACTCTGTATCTCATCTTTCCGTGCCGGAGCGGATAGAGAAAAAGAGGAGAGAGGCGCTAGTTGGCGGGGGAGAGCAGCGCATAGAGGCTCAGCACAGAAGGGGAAAGTTGACGGCGAGGGAACGGATCAGTCTCCTGTTGGACCCGGGGAGCTTTGCAGAATATGATATGTTTGTGGAGCACCGATGCTCAGATTTTGGGATGGAAGAGGACAGGAATAAGTATCCTGGGGACAGTGTAGTGACGGGACAAGGCCGCATTAATGGGAGGCTAGTTTATGTCTTCAGCCAGGATTTTACTGTTTTTGGGGGCAGTTTATCTGGGGCACATGCTCAAAAGATCTGCAAGATCATGGACCAGGCTGTCATGGTGGGAGCTCCTGTTATTGGACTCAATGACTCAGGAGGGGCTCGTATCCAGGAAGGTGTGGAGTCACTGGCTGGCTATGCTGATATATTCTTGAGGAACGTGCTGAGCTCAGGGGTTGTCCCACAGATTTCCCTGATTATGGGGCCTTGTGCTGGGGGGTGCAGTCTACTCACCAGCATTAACAGAACTTTACATTTATGGTGAAGGATACTTCCTACCTATTCATCACTTGGCCCGATGTAGTAAAGTCCGTTACCAATGAGAATGTGACGCANGAAAAACTTGGGAAGAGCCAAAACCCACATGCCGATGGTCAGGGGGTGCTTCATCCCGGCTTTTGAAAAATGAAATTTAATGCCTTATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTGTTCGCAGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ830259
dbEST ID: 79647961
Trimmed Sequence: TAAAGGAATATTTGCATGTTTCTTCCAAGGATTCACTTGTTGCTTGCTCGCAAGTACCTCCAGGTCACGACAGATGCGCATTCGTGTTTTAGATGGCTGAATTATGTCATCAACGAACCCTCTCACTGCAGCAGGGAACGGGTTGGCAAATTTCTCAACGTATTCTTCCTCCGCCTCTGCTTGATTCTGCTTCCCACGGAATATGATCTGAACAGCCCCCTTAGCTCCCATGACAGCGACTTCAGCTGTTGGCCATGCATAGTTCACATCGCCTCTCAGATGCTTAGAGCTCATCACATCATAGGCCCCTCCATAAGCCTTTCTGGTGATCACTGTGATCTTTGGGACGGTGGCCTCTGCAAAGGCAAACAACAGTTTTGCTCCATGTCTGATAATCCCGCCGTACTCCTGGGCAGTACCTGGTAAAAATCCTGGCACATCGACAAAAGTGATAATGGGTATATTGAAGGCATCGCAGAATCTGACAAAGCGGGCTCCTTTCACAGAGGAATTAATGTCCAAGCAGCCTGAGGCCACCTTAGGCTGGTTACCCACAATGCCAACTGTCCTTCCATTCATCCTGGCAAATCCAACTACAATGTTCTTGGCATAGTTTGGCATGATTTCAAAGAATTCCCTCTCATCAATAATCGAGTGTATGATATCCAGCATGTCATAAGCTTTTGTGGACTCCATGGAAACAACTGTATCCAGTCCAGGAAACCAAGGCGGTCACTTTGAAACGTGGAACCTTTCTTGAACGGGGTGG
Full Trace Sequence: TGCCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAAGGAATATTTGCATGTTTCTTCCAAGGATTCACTTGTTGCTTGCTCGCAAGTACCTCCAGGTCACGACAGATGCGCATTCGTGTTTTAGATGGCTGAATTATGTCATCAACGAACCCTCTCACTGCAGCAGGGAACGGGTTGGCAAATTTCTCAACGTATTCTTCCTCCGCCTCTGCTTGATTCTGCTTCCCACGGAATATGATCTGAACAGCCCCCTTAGCTCCCATGACAGCGACTTCAGCTGTTGGCCATGCATAGTTCACATCGCCTCTCAGATGCTTAGAGCTCATCACATCATAGGCCCCTCCATAAGCCTTTCTGGTGATCACTGTGATCTTTGGGACGGTGGCCTCTGCAAAGGCAAACAACAGTTTTGCTCCATGTCTGATAATCCCGCCGTACTCCTGGGCAGTACCTGGTAAAAATCCTGGCACATCGACAAAAGTGATAATGGGTATATTGAAGGCATCGCAGAATCTGACAAAGCGGGCTCCTTTCACAGAGGAATTAATGTCCAAGCAGCCTGAGGCCACCTTAGGCTGGTTACCCACAATGCCAACTGTCCTTCCATTCATCCTGGCAAATCCAACTACAATGTTCTTGGCATAGTTTGGCATGATTTCAAAGAATTCCCTCTCATCAATAATCGAGTGTATGATATCCAGCATGTCATAAGCTTTTGTGGACTCCATGGAAACAACTGTATCCAGTCCAGGAAACCAAGGCGGTCACTTTGAAACGTGGAACCTTTCTTGAACGGGGTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAAGGAATATTTGCATGTTTCT