ORFeome > phr ORF1 – XORFeome v1.0

phr ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: phr
Gene ID: 5753934
Gene Page ID: 5753918
ORF Xenbase ID: 17289129

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133744
Original XGC clone length: 1674

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ838582
dbEST ID: 79656284
Trimmed Sequence: ATGTCTCACAAGGGTAAGCAATCCAAACCCAAAGATGGAGAATCCGGAAGTGAAAAATCAGACGGAAGCCAGAAAAAAGGAATGGGGATTGATGCAAAAACAAAGACGCAGACAATAACAAAGAGCCCAGGAAAAAGGAAGATTCCGGGGAAAGTATTATCAGATAGCAGTGGAGACAGCTCTGGTGTGGATGCTAAAAAGAAGAAAACTATGGTGGAGCAGAAGGGGGAAAAGGATGTCAGAGAAGCTGTTAAGATATCCCGTATGGCAGCAGCCCCCTCTGTATCTGAATTTAAATTTAACAAGAAAAGGGCTCGGTTGCTATCCACCGAAGCGGATCTTAAAGAAGATGCTCAAGGGATAGTGTACTGGATGTCACGGGACCAGAGAGTTCAAGACAACTGGGCCTTTCTCTATGCTCAGCGTCTGGCTCTCAAGCAGAAGCTTCCATTACATGTTACATTTTGCCTGGTTCCTAAATTCTTGGATGCCACAATCCGTCATTATGGCTTCATGCTGAAGGGTCTGCACGAAGTTGCTGAGGAGTGCAAAAACTAAACATCCCTTTTCACCTTCTTATTGGAATGCAAAAGACATTCTGCCCAACCTTGTTAATGATCATGCCAATGGGGGGAGTTTGGACTGAATTTCCTCCGTTGCCTGTCCCCTTGCGTTGAGGGGAGGGGGGGGGGAAGGTGTCGCACAGAGGAATTTACAGATTGGTGAAGATGGAAGGGAGGAGAGAGGTGGTCCATTGATTTTTGGTGGCTGCGTGTTTGGCTCCTATATATACGGAAACCCAAAAACTTAATCGGCTGAA
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTCACAAGGGTAAGCAATCCAAACCCAAAGATGGAGAATCCGGAAGTGAAAAATCAGACGGAAGCCAGAAAAAAGGAATGGGGATTGATGCAAAAACAAAGACGCAGACAATAACAAAGAGCCCAGGAAAAAGGAAGATTCCGGGGAAAGTATTATCAGATAGCAGTGGAGACAGCTCTGGTGTGGATGCTAAAAAGAAGAAAACTATGGTGGAGCAGAAGGGGGAAAAGGATGTCAGAGAAGCTGTTAAGATATCCCGTATGGCAGCAGCCCCCTCTGTATCTGAATTTAAATTTAACAAGAAAAGGGCTCGGTTGCTATCCACCGAAGCGGATCTTAAAGAAGATGCTCAAGGGATAGTGTACTGGATGTCACGGGACCAGAGAGTTCAAGACAACTGGGCCTTTCTCTATGCTCAGCGTCTGGCTCTCAAGCAGAAGCTTCCATTACATGTTACATTTTGCCTGGTTCCTAAATTCTTGGATGCCACAATCCGTCATTATGGCTTCATGCTGAAGGGTCTGCACGAAGTTGCTGAGGAGTGCAAAAACTAAACATCCCTTTTCACCTTCTTATTGGAATGCAAAAGACATTCTGCCCAACCTTGTTAATGATCATGCCAATGGGGGGAGTTTGGACTGAATTTCCTCCGTTGCCTGTCCCCTTGCGTTGAGGGGAGGGGGGGGGGAAGGTGTCGCACAGAGGAATTTACAGATTGGTGAAGATGGAAGGGAGGAGAGAGGTGGTCCATTGATTTTTGGTGGCTGCGTGTTTGGCTCCTATATATACGGAAACCCAAAAACTTAATCGGCTGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCACAAGGGTAAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838581
dbEST ID: 79656283
Trimmed Sequence: TTGGCTGAACTTCTTTGGGTGATAGCGCCGCTCAAACTGTGCCACGTCAAATTTTCTCTTACACCCCTGGTAGTTCATGTAGCGAATCTTCCCAAACACTGCCCGCTCAGCCCAGCCCTGGTCATGGATCCCACAGATTGACCACATGCAGCCTACATATCCATTAGGGTCCCTTCCATCCAACTCATAGCGGTCATTGAGGTAAAGGGAAAAATGAAGTGCCTCCTCTGGAGAACTTGTCCACTCTAGGATCTTTTTGGCCCAGTACATCCTCAGGAATCCATGCATTTTCCCTTCATGCACCATCTGGAGCTGGGCAGCATTCCACAAAGGATCATGAGTCTTGCCAGCCTCTAGTTTTTCCAAAGTGTACAGGTGAGTCCTCTTGTCCTTTGCATGATCCTTTAAAGTATTTTTTGCCCAGTCATAAGCACCTTCAATTTTGTCATAATTCTTGTTATAGAAGCAAAAGTTGTCCGCCAGCTCCCGTCTCACCACAGCTTCTTCCACAAAACTATCTACAGATTCCTTGAACTTACTGCGATATTTCTGAACTTCAAGAATTGCCCGCTGGACTGACAGCTGTCCCAAGTGAAACCATGGAGAACAGTTGCTAAAAACATTTTTGGTTGGGATTATTTCTGTCTGAAATTAAAATGCCTTAAGACGCCTCCCAAAAAAAGGAATGCAAATAAATTTAAATCCCGGCCATTTGTTTCCAGGCTTTTTGCCATTTCCCCTTCCCCCAAACCGTCCCGGAATCCCACT
Full Trace Sequence: AAACAAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGGCTGAACTTCTTTGGGTGATAGCGCCGCTCAAACTGTGCCACGTCAAATTTTCTCTTACACCCCTGGTAGTTCATGTAGCGAATCTTCCCAAACACTGCCCGCTCAGCCCAGCCCTGGTCATGGATCCCACAGATTGACCACATGCAGCCTACATATCCATTAGGGTCCCTTCCATCCAACTCATAGCGGTCATTGAGGTAAAGGGAAAAATGAAGTGCCTCCTCTGGAGAACTTGTCCACTCTAGGATCTTTTTGGCCCAGTACATCCTCAGGAATCCATGCATTTTCCCTTCATGCACCATCTGGAGCTGGGCAGCATTCCACAAAGGATCATGAGTCTTGCCAGCCTCTAGTTTTTCCAAAGTGTACAGGTGAGTCCTCTTGTCCTTTGCATGATCCTTTAAAGTATTTTTTGCCCAGTCATAAGCACCTTCAATTTTGTCATAATTCTTGTTATAGAAGCAAAAGTTGTCCGCCAGCTCCCGTCTCACCACAGCTTCTTCCACAAAACTATCTACAGATTCCTTGAACTTACTGCGATATTTCTGAACTTCAAGAATTGCCCGCTGGACTGACAGCTGTCCCAAGTGAAACCATGGAGAACAGTTGCTAAAAACATTTTTGGTTGGGATTATTTCTGTCTGAAATTAAAATGCCTTAAGACGCCTCCCAAAAAAAGGAATGCAAATAAATTTAAATCCCGGCCATTTGTTTCCAGGCTTTTTGCCATTTCCCCTTCCCCCAAACCGTCCCGGAATCCCACT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGCTGAACTTCTTTGGG