ORFeome > pla2g2e ORF1 – XORFeome v1.0

pla2g2e ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pla2g2e
Gene ID: 5756021
Gene Page ID: 5756013
ORF Xenbase ID: 17289471

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078486
Original XGC clone length: 444

Human orthology & disease relationships

NCBI Entrez ID: 30814
Ensembl gene IDs: ENSG00000188784
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 211980,607785,608594

Library Location

Plate ID: GDExl11005
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ839926
dbEST ID: 79657628
Trimmed Sequence: ATGAAAAAGGTTCTTCTCATCGGAGTGGCTTTGGCTCTCATTATAGTTCTGGTCACCAGCACACCAGCCCAGTTTGACGAGATGATTAAAGTGACCACCATCATTTATGGCCTGGCTAACTTCTCTGACTATGGATGCCACTGCGGCCTGAACAACCAAGGAATGCCTGTGGACGACATTGATTGGTGCTGCCACAGCCAAGACTGCTGCTATAACAAGGCTGAAATGAGCGGATGCAACCCTGTTACACAGACTTACAGGTTCTATGTTGAGGAACAGAAGAAAGTAGAGTGCATGAAAGCAAGTAATCGCTGTGAGAAGATGATCTGCGAATGTGATGAAAAGGCTGCAAACTGTTTCCGCAAGGAACTGGAAGATTATAACATATATTTCCGCAATTTCTCTTCTCTGGGGGCATGCCGAGGGCCCAGACCTTTTTGCTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAAAAGGTTCTTCTCATCGGAGTGGCTTTGGCTCTCATTATAGTTCTGGTCACCAGCACACCAGCCCAGTTTGACGAGATGATTAAAGTGACCACCATCATTTATGGCCTGGCTAACTTCTCTGACTATGGATGCCACTGCGGCCTGAACAACCAAGGAATGCCTGTGGACGACATTGATTGGTGCTGCCACAGCCAAGACTGCTGCTATAACAAGGCTGAAATGAGCGGATGCAACCCTGTTACACAGACTTACAGGTTCTATGTTGAGGAACAGAAGAAAGTAGAGTGCATGAAAGCAAGTAATCGCTGTGAGAAGATGATCTGCGAATGTGATGAAAAGGCTGCAAACTGTTTCCGCAAGGAACTGGAAGATTATAACATATATTTCCGCAATTTCTCTTCTCTGGGGGCATGCCGAGGGCCCAGACCTTTTTGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAAGCTGTAAAAAAAAAAATAAAAAAACATATCTCAATCCACTCTATCGATACCACGGGGGAAAAAAAAAAAAAGACCCCCCCCCCCCAGCGGGGGGGCGGGTTGCGCTCGGGTGGGGGGGGAGGAGGCCCAAAAAAAGAAAAAACCAAGGGGGGGGTAAAGTAGGAGGAGAGAAGAGTGGCGGGGGGCGCCCGCGCCCCACACAAAACAAAACAAAAACAGAGGGGGGGGGCGGCGGGGGGTTGTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAAAGGTTCTTCTCATCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839925
dbEST ID: 79657627
Trimmed Sequence: GCAAAAAGGTCTGGGCCCTCGGCATGCCCCCAGAGAAGAGAAATTGCGGAAATATATGTTATAATCTTCCAGTTCCTTGCGGAAACAGTTTGCAGCCTTTTCATCACATTCGCAGATCATCTTCTCACAGCGATTACTTGCTTTCATGCACTCTACTTTCTTCTGTTCCTCAACATAGAACCTGTAAGTCTGTGTAACAGGGTTGCATCCGCTCATTTCAGCCTTGTTATAGCAGCAGTCTTGGCTGTGGCAGCACCAATCAATGTCGTCCACAGGCATTCCTTGGTTGTTCAGGCCGCAGTGGCATCCATAGTCAGAGAAGTTAGCCAGGCCATAAATGATGGTGGTCACTTTAATCATCTCGTCAAACTGGGCTGGTGTGCTGGTGACCAGAACTATAATGAGAGCCAAAGCCACTCCAATGAGAAGAACCTTTTTCATGG
Full Trace Sequence: GGTGTAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAAAAAGGTCTGGGCCCTCGGCATGCCCCCAGAGAAGAGAAATTGCGGAAATATATGTTATAATCTTCCAGTTCCTTGCGGAAACAGTTTGCAGCCTTTTCATCACATTCGCAGATCATCTTCTCACAGCGATTACTTGCTTTCATGCACTCTACTTTCTTCTGTTCCTCAACATAGAACCTGTAAGTCTGTGTAACAGGGTTGCATCCGCTCATTTCAGCCTTGTTATAGCAGCAGTCTTGGCTGTGGCAGCACCAATCAATGTCGTCCACAGGCATTCCTTGGTTGTTCAGGCCGCAGTGGCATCCATAGTCAGAGAAGTTAGCCAGGCCATAAATGATGGTGGTCACTTTAATCATCTCGTCAAACTGGGCTGGTGTGCTGGTGACCAGAACTATAATGAGAGCCAAAGCCACTCCAATGAGAAGAACCTTTTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCACAACCTTAATACAGACCATCGTTTAACATTCTGGGTTACTTGGGGGGGTTAAAAAGGCAACCTCCCCGTACACCCAGGGGGTGGGGTTTGGCCCGTTTTTTGTGGGGGAGGGCCCTCAGAAAAGAAAACCAAACAGGAGGGAATTAAGCGTTGGGATACGATGCAAGGGGGCGCGCGCGGGGTGGACCCAAACCAAACACAAAAAAAGGTGTTTGGCCCGCGGCGCGTTTGTGGTGTGTGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAAAAAGGTCTGGGCCCTC