ORFeome > prdm12 ORF1 – XORFeome v1.0

prdm12 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prdm12
Gene ID: 953734
Gene Page ID: 953728
ORF Xenbase ID: 17290659

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056019
Original XGC clone length: 1068

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ824664
dbEST ID: 79642366
Trimmed Sequence: ATGATGGGCTCGGTGCTGCCGGCTGAAGCGTTGGTGCTGAAGGCTGGGCTCAAACAGCCAGGGCTCTCCTTGGCAGAGCTCATTACCTCGGACATCCTACACAGCTTCCTCTATGGGCGCTGGAGAAACGTCTTAGGGGAACAACTGTTTGAGGAGAAGAACAATCACATCAGCCCCAAAACTGCTTTCACCGCAGAGGTCCTGGCACAGTCCTTCTCAGGGGAAGTCCAGAAGCTCTCCAGCTTGGTGCTGCCCTCTGAAGTCATCATTGCCCAGAGTTCCATTCCTGGTGAGGGACTGGGCATCTTCTCCAAGACCTGGATCAAAGCTGGCACAGAGATGGGTCCTTTCACTGGCAGAGTCATTTCCCCAGAGCATGTGGATCTGTGCAAAAACAACAACCTGATGTGGGAGGTGTTTAATGAAGATGGCACCGTGCGCTATTTTATTGATGCCAGCCAAGAGGACCATCGCAGTTGGATGACGTACATCAAGTGTGCAAGGAATGAGCAAGAGCAGAACCTGGAGGTTGTGCAGATTGGCAACAGCATCTTCTACAAAGCCACCGAGACTATCCCACCGGATCAGGAGTTGTTGGTTTGGTATGGAAATTCCCTGAGTAGCTTCCTTGGAATCCCAGGGGTACCAGGAAATGGAAGAGGAACAGAAAAAGACCAAGCAAGAGGATTTTGGAATCGTGGACTCCACAGGGCCGTCGCTAGCAGGCCCGCAGCCTTTGTGTCATTTGCC
Full Trace Sequence: GCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGGGCTCGGTGCTGCCGGCTGAAGCGTTGGTGCTGAAGGCTGGGCTCAAACAGCCAGGGCTCTCCTTGGCAGAGCTCATTACCTCGGACATCCTACACAGCTTCCTCTATGGGCGCTGGAGAAACGTCTTAGGGGAACAACTGTTTGAGGAGAAGAACAATCACATCAGCCCCAAAACTGCTTTCACCGCAGAGGTCCTGGCACAGTCCTTCTCAGGGGAAGTCCAGAAGCTCTCCAGCTTGGTGCTGCCCTCTGAAGTCATCATTGCCCAGAGTTCCATTCCTGGTGAGGGACTGGGCATCTTCTCCAAGACCTGGATCAAAGCTGGCACAGAGATGGGTCCTTTCACTGGCAGAGTCATTTCCCCAGAGCATGTGGATCTGTGCAAAAACAACAACCTGATGTGGGAGGTGTTTAATGAAGATGGCACCGTGCGCTATTTTATTGATGCCAGCCAAGAGGACCATCGCAGTTGGATGACGTACATCAAGTGTGCAAGGAATGAGCAAGAGCAGAACCTGGAGGTTGTGCAGATTGGCAACAGCATCTTCTACAAAGCCACCGAGACTATCCCACCGGATCAGGAGTTGTTGGTTTGGTATGGAAATTCCCTGAGTAGCTTCCTTGGAATCCCAGGGGTACCAGGAAATGGAAGAGGAACAGAAAAAGACCAAGCAAGAGGATTTTGGAATCGTGGACTCCACAGGGCCGTCGCTAGCAGGCCCGCAGCCTTTGTGTCATTTGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGGGCTCGGTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ830016
dbEST ID: 79647718
Trimmed Sequence: CAGCACCATGGTTGGAATGTGGTGTGCCAGGGTGGCAGGGTGTGGCACTGGCAAGGTTGGGGAATGGGTCTGCAAGGAACCATTGGGTGGACGGTGCCTGGCGCTTTTCTGATGGGCTCGTAGGCCGGCCAGCTGTGAGTAGGCGCTTTGGCACACTTGGCATTTATACGGGCGCTCCCCAGTGTGCAGGCGGACGTGGTTACGTAGGGTAGAGGACTGGCTGAAGCGGCGGTTGCAGAAGCGGCAGACAAAGGGCTTGTCTAGGGTGTGGATGCGCATGTGGGAGCGCAGGTTGCTGCGAGAATTGAAACCACGGTGGCAAATGACACAACGCATGCGGCCTGCTAGCGACGGCCCTGTGGAGTCCACGATTCCAAATTCCTCTTGCTTGTTCTTTTTCTGTTCCTCTTCCATTCCTGGTACCCCTGGGATTCCAAGGAAGCTACTCAGGGAATTTCCATACCAAACCAACAACTCCTGATCCGGTGGGATAGTCTCGGTGGCTTTGTAGAAGATGCTGTTGCCAATCTGCACAACCTCCAGGTTCTGCTCTTGCTCATTCCTTGCACACTTGATGTACGTCATCCCACTGCGATGGTCCTCTTGGCTGGCATCAATAAAATAACGCAAGGTGCCATCTTCATTAAACACCTCCCACCATCAGGTTGTTGTTTTTTTCACAGAATCCACCATGCCTCCGGGGGGAAAATGACTCCTTCCCAATTGAAAAAGGACCCCCATCCTCTTGTTGCCCAAC
Full Trace Sequence: GGCTGACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGCACCATGGTTGGAATGTGGTGTGCCAGGGTGGCAGGGTGTGGCACTGGCAAGGTTGGGGAATGGGTCTGCAAGGAACCATTGGGTGGACGGTGCCTGGCGCTTTTCTGATGGGCTCGTAGGCCGGCCAGCTGTGAGTAGGCGCTTTGGCACACTTGGCATTTATACGGGCGCTCCCCAGTGTGCAGGCGGACGTGGTTACGTAGGGTAGAGGACTGGCTGAAGCGGCGGTTGCAGAAGCGGCAGACAAAGGGCTTGTCTAGGGTGTGGATGCGCATGTGGGAGCGCAGGTTGCTGCGAGAATTGAAACCACGGTGGCAAATGACACAACGCATGCGGCCTGCTAGCGACGGCCCTGTGGAGTCCACGATTCCAAATTCCTCTTGCTTGTTCTTTTTCTGTTCCTCTTCCATTCCTGGTACCCCTGGGATTCCAAGGAAGCTACTCAGGGAATTTCCATACCAAACCAACAACTCCTGATCCGGTGGGATAGTCTCGGTGGCTTTGTAGAAGATGCTGTTGCCAATCTGCACAACCTCCAGGTTCTGCTCTTGCTCATTCCTTGCACACTTGATGTACGTCATCCCACTGCGATGGTCCTCTTGGCTGGCATCAATAAAATAACGCAAGGTGCCATCTTCATTAAACACCTCCCACCATCAGGTTGTTGTTTTTTTCACAGAATCCACCATGCCTCCGGGGGGAAAATGACTCCTTCCCAATTGAAAAAGGACCCCCATCCTCTTGTTGCCCAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCACCATGGTTGGAAT