ORFeome > prkra ORF1 – XORFeome v1.0

prkra ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: prkra
Gene ID: 940708
Gene Page ID: 940705
ORF Xenbase ID: 17290875

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043873
Original XGC clone length: 930

Human orthology & disease relationships

NCBI Entrez ID: 8575
Ensembl gene IDs: ENSG00000180228
Directly associated (OMIM) disease MIM numbers: 612067
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ823899
dbEST ID: 79641601
Trimmed Sequence: ATGTCCCAGGAGAGGTTTCCAGCCGCGCCCAAAATGAGCTCTGAGAAACCCACCAGCTTAGATGCGATGCGTGCAACAAATCCATGCGAGACCCCCATTCAGCTGCTGCATGAATTTGGAACAAAGACTGGTAACCATCCCGTGTACACCTTAGAGAAAGCAGAAGGACAAGCACATAACCCTAGTTTCACATTTCGGTTGGTTATTGGTGACATAACTAGCTTAGGAGAGGGACCTAGCAAGAAAACTGCAAAACAAAAAGCAGCTGAATTTGCACTGAACATATTACGAGGCGACACTAGCAAGTGTCTGCCTGTAACGGATACTTTAAGGGATCCCAAGAAACCACCAAATCAGATGCAGGAAAATCCTGTTGGCTCACTACAGGAATTAGCTGTGCAAAAAGGATGGCGCCTCCCAGAATATACCGTGGCACAAGAGTCTGGCCCTCCTCACAAGAGAGAATTCACCATAACTTGCCGTGTGGAAACCTTTGTAGAAACTGGATCGGGAACCTCTAAACAAGTGGCTAANAGGGTTGCTGCAGAAAAACTCCTTACCAAATTTAAGACCATTTCAACTGATAATATACCTCTGAACAAGCTGATTGGAAATAAAATGGGCTGCACCTGGGACAGCATGAGAAACTCATCTGGGGAAAAGATAGCATGCTGAAAAAAGCCCTCTCATATCTCCACACTGATTATGTGAGATGCTCAAAGATGTAGCCGAAAGACAGACTTCACCTCCCTATTTGGAATAAATTAAACTGAGGGTTATGGAAAAAACCAGTGTTTGGTGAAATGTCCAAAAACCAAAAACGTTTGCCCGGGAAACGG
Full Trace Sequence: TATTGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCCAGGAGAGGTTTCCAGCCGCGCCCAAAATGAGCTCTGAGAAACCCACCAGCTTAGATGCGATGCGTGCAACAAATCCATGCGAGACCCCCATTCAGCTGCTGCATGAATTTGGAACAAAGACTGGTAACCATCCCGTGTACACCTTAGAGAAAGCAGAAGGACAAGCACATAACCCTAGTTTCACATTTCGGTTGGTTATTGGTGACATAACTAGCTTAGGAGAGGGACCTAGCAAGAAAACTGCAAAACAAAAAGCAGCTGAATTTGCACTGAACATATTACGAGGCGACACTAGCAAGTGTCTGCCTGTAACGGATACTTTAAGGGATCCCAAGAAACCACCAAATCAGATGCAGGAAAATCCTGTTGGCTCACTACAGGAATTAGCTGTGCAAAAAGGATGGCGCCTCCCAGAATATACCGTGGCACAAGAGTCTGGCCCTCCTCACAAGAGAGAATTCACCATAACTTGCCGTGTGGAAACCTTTGTAGAAACTGGATCGGGAACCTCTAAACAAGTGGCTAANAGGGTTGCTGCAGAAAAACTCCTTACCAAATTTAAGACCATTTCAACTGATAATATACCTCTGAACAAGCTGATTGGAAATAAAATGGGCTGCACCTGGGACAGCATGAGAAACTCATCTGGGGAAAAGATAGCATGCTGAAAAAAGCCCTCTCATATCTCCACACTGATTATGTGAGATGCTCAAAGATGTAGCCGAAAGACAGACTTCACCTCCCTATTTGGAATAAATTAAACTGAGGGTTATGGAAAAAACCAGTGTTTGGTGAAATGTCCAAAAACCAAAAACGTTTGCCCGGGAAACGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCCAGGAGAGGTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829208
dbEST ID: 79646910
Trimmed Sequence: CTTTTTAATACACATGATTTTTAAATACTGCAGTGCATTGTGTGCAGCATCATTGTGTGCATTGCCACAAGAGATCCCAGTTCCGTGGCACACAGTTATGGGATTTGTGGACAGTTCAGCAAGACATTGGTACTGTCCATTAACACTCAGTTCATCTATATCCAAATAGGTGAGGTTGAAGTCTAGTTCTTCGGCTACATCTTTGAGCATTTTCACATAATCAGTGTTGGGAATACTGAGAGGGCTTCTTTTCAGCATGCTTATCTTTTCCCCAGATGAGTTTCTCATGCTGTCCCAGGTGCAGCCCATTTTATTTCCAATCAGCTTGTTCAGAGGTATATTATCAGTTGAAATGGTCTTAAATTTGGTAAGGAGTTTCTCTGCAGCAACCCTTTTAGCCACTTGTTTAGAGGTTCCCGATCCAGTTTCTACAAAGGTTTCCACACGGCAAGTTATGGTGAATTCTCTCTTGTGAGGAGGGCCAGACTCTTGTGCCACGGTATATTCTGGGAGGCGCCATCCTTTTTGCACAGCTAATTCCTGTAGTGAGCCAACAGGATTTTCCTGCATCTGATTTGGTGGTTTCTTGGGATCCCCTAAAGTATCCATTACAAGGCGACACTTGGCTAGTGTCCGCCTCGTAATATGTTCAGTGGCAAATTCAGCTGCTTTTTTGTTTTGCAGTTTTTCTTTGCTAGGGTCCCCCCCCCAAAGCTAAGTTATTGTTCACCCAAAAAACCCAACCGAAAAA
Full Trace Sequence: GGGCGAGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTTTAATACACATGATTTTTAAATACTGCAGTGCATTGTGTGCAGCATCATTGTGTGCATTGCCACAAGAGATCCCAGTTCCGTGGCACACAGTTATGGGATTTGTGGACAGTTCAGCAAGACATTGGTACTGTCCATTAACACTCAGTTCATCTATATCCAAATAGGTGAGGTTGAAGTCTAGTTCTTCGGCTACATCTTTGAGCATTTTCACATAATCAGTGTTGGGAATACTGAGAGGGCTTCTTTTCAGCATGCTTATCTTTTCCCCAGATGAGTTTCTCATGCTGTCCCAGGTGCAGCCCATTTTATTTCCAATCAGCTTGTTCAGAGGTATATTATCAGTTGAAATGGTCTTAAATTTGGTAAGGAGTTTCTCTGCAGCAACCCTTTTAGCCACTTGTTTAGAGGTTCCCGATCCAGTTTCTACAAAGGTTTCCACACGGCAAGTTATGGTGAATTCTCTCTTGTGAGGAGGGCCAGACTCTTGTGCCACGGTATATTCTGGGAGGCGCCATCCTTTTTGCACAGCTAATTCCTGTAGTGAGCCAACAGGATTTTCCTGCATCTGATTTGGTGGTTTCTTGGGATCCCCTAAAGTATCCATTACAAGGCGACACTTGGCTAGTGTCCGCCTCGTAATATGTTCAGTGGCAAATTCAGCTGCTTTTTTGTTTTGCAGTTTTTCTTTGCTAGGGTCCCCCCCCCAAAGCTAAGTTATTGTTCACCCAAAAAACCCAACCGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTTAATACACATGA