ORFeome > prph2 ORF1 – XORFeome v1.0

prph2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: prph2
Gene ID: 985595
Gene Page ID: 985593
ORF Xenbase ID: 17291049

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054965
Original XGC clone length: 1053

Human orthology & disease relationships

NCBI Entrez ID: 5961
Ensembl gene IDs: ENSG00000112619
Directly associated (OMIM) disease MIM numbers: 136880,169150,608133,608161,613105
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ839279
dbEST ID: 79656981
Trimmed Sequence: ATGGCCCTGATGAAAACAAAATTCAATCTAAAGAGGAGAGTGAAACTGGCCCAAGGGCTATGGTTCATGAACTGGTGCTGCGTCTTAGCAGGCATTGCCCTTTTCAGCATGGGGATATTCCTGAAAATTGAGCTCAGAAAGCGCAGCGAGGTGATGGATAATGAAGAGAGCCACTTTGTACCCAATTCTTTAATACTGATGGGAGCCCTGGCCTGTGCCCTTAATGCATTTGCAGGTAAAATCTGCTATGATTCCCTGGATCCTAACAAGTTTGCCAAGTGGAAGCCCATGCTGAAACCTTATCTGATCGTCTGTCTCCTCTTCAACGTCTTCATATTCTTCACCGGTGTGGTCTGCTTCTTAACCAGGGGCTCCTTGGAGAGCACCTTGGCACACGGCTTAAAGAATGGCATGCGATACTACAAGGATACCGATACCCCCGGCAGGTGCTTTATGAAGAAGACCATTGACTTGCTGCAGATTGAGTTCAAATGCTGCGGAAACAAGGGCTTCAGGGACTGGTTTGAGCTCCAGTGGATCAGCAACCGCTATCTGGACTTCAGCTCCNAGGAAGTGAAAGATCGAATTAAGAGCAACGTTGACGGCNAGTTTTTGATTGACGGGGTTCCCTTCAGTTGCTGCCACCCGAGCTCCCCCAGGCCCTGCATTCAGCTGCAAGTGAACAATAACTCAACTCATTACAGTTTCGATCACCAAAAAAAGGAATTTAAACCGGTGGGCCCAAAGGCCTGCAAAGGAAGCTCTGCCGGAACTACTACACCCAATATGAAAAAAGCTTCCCAGGGGGTGG
Full Trace Sequence: TCGAGGGCCAAATAANTGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCCTGATGAAAACAAAATTCAATCTAAAGAGGAGAGTGAAACTGGCCCAAGGGCTATGGTTCATGAACTGGTGCTGCGTCTTAGCAGGCATTGCCCTTTTCAGCATGGGGATATTCCTGAAAATTGAGCTCAGAAAGCGCAGCGAGGTGATGGATAATGAAGAGAGCCACTTTGTACCCAATTCTTTAATACTGATGGGAGCCCTGGCCTGTGCCCTTAATGCATTTGCAGGTAAAATCTGCTATGATTCCCTGGATCCTAACAAGTTTGCCAAGTGGAAGCCCATGCTGAAACCTTATCTGATCGTCTGTCTCCTCTTCAACGTCTTCATATTCTTCACCGGTGTGGTCTGCTTCTTAACCAGGGGCTCCTTGGAGAGCACCTTGGCACACGGCTTAAAGAATGGCATGCGATACTACAAGGATACCGATACCCCCGGCAGGTGCTTTATGAAGAAGACCATTGACTTGCTGCAGATTGAGTTCAAATGCTGCGGAAACAAGGGCTTCAGGGACTGGTTTGAGCTCCAGTGGATCAGCAACCGCTATCTGGACTTCAGCTCCNAGGAAGTGAAAGATCGAATTAAGAGCAACGTTGACGGCNAGTTTTTGATTGACGGGGTTCCCTTCAGTTGCTGCCACCCGAGCTCCCCCAGGCCCTGCATTCAGCTGCAAGTGAACAATAACTCAACTCATTACAGTTTCGATCACCAAAAAAAGGAATTTAAACCGGTGGGCCCAAAGGCCTGCAAAGGAAGCTCTGCCGGAACTACTACACCCAATATGAAAAAAGCTTCCCAGGGGGTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCTGATGAAAACAAAATTC

Sequences - 3ʹ (reverse) EST

Accession: JZ839278
dbEST ID: 79656980
Trimmed Sequence: GCTGACAGTTGCTACTCCTGCTTCTTTGTCTCCTCCCTCACCTCCAGCGGTCTCCACCTTGTTCAGCTTACCCATGCCCTTCACCAGTTCCCAGGAGGATTTGATGGTGTCCTTCAGGCTTTTCTCCAGTATCCAACCTTCGCTCTCACACTCGGGATCTTCAGGGTTTGCAATGCTCTCCAAACACGTGTGCAAAAACCTCAGCCCGATCATCACAGCCATCTCCATGATCCAGACCAGAAAGACCATGCCACCCATGGAGCTCATCATACTGGTGTAGTAGTTCAGCAGAGCTTCCTTGCAGCCTTTGGGCCACAGGTTCAACTCCTCTGTCTGGTGATCGTAACTGTAATGAGCTGAGTTATTTGTCACTTGCAGCTGAATGCAGGGCCTGGGGGAGCTCGGGTTGCAGCAACTGAAGGGAACCCCGTCAATCAAAAACTTGCCGTCAACGTTGCTCTTAATTCGATCTTTCACTTCCTTGGAGCTGAAGTCCAGATAGCGGTTGCTGATCCACTGGAGCTCAAACCAGTCCCTGAAGCCCTTGTTTCCGCAGCATTTGAACTCAATCTGCAGCAAGTCAATGGTCTTCTTCATAAAGCACCTGCCCGGGGTATCGGTATCCTTGTATTATCGCATGGCATTCTTTAAGCCGTGTGCCAAGGGGCTCTCCCAAGACCCCCTGGTTAAAAAAGCAAAACACAACCGGTTAAAAAAAATTAAAAAATTTTAAAAAAGGAAAAAAAAACCAAATCAAAAAAG
Full Trace Sequence: CGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGACAGTTGCTACTCCTGCTTCTTTGTCTCCTCCCTCACCTCCAGCGGTCTCCACCTTGTTCAGCTTACCCATGCCCTTCACCAGTTCCCAGGAGGATTTGATGGTGTCCTTCAGGCTTTTCTCCAGTATCCAACCTTCGCTCTCACACTCGGGATCTTCAGGGTTTGCAATGCTCTCCAAACACGTGTGCAAAAACCTCAGCCCGATCATCACAGCCATCTCCATGATCCAGACCAGAAAGACCATGCCACCCATGGAGCTCATCATACTGGTGTAGTAGTTCAGCAGAGCTTCCTTGCAGCCTTTGGGCCACAGGTTCAACTCCTCTGTCTGGTGATCGTAACTGTAATGAGCTGAGTTATTTGTCACTTGCAGCTGAATGCAGGGCCTGGGGGAGCTCGGGTTGCAGCAACTGAAGGGAACCCCGTCAATCAAAAACTTGCCGTCAACGTTGCTCTTAATTCGATCTTTCACTTCCTTGGAGCTGAAGTCCAGATAGCGGTTGCTGATCCACTGGAGCTCAAACCAGTCCCTGAAGCCCTTGTTTCCGCAGCATTTGAACTCAATCTGCAGCAAGTCAATGGTCTTCTTCATAAAGCACCTGCCCGGGGTATCGGTATCCTTGTATTATCGCATGGCATTCTTTAAGCCGTGTGCCAAGGGGCTCTCCCAAGACCCCCTGGTTAAAAAAGCAAAACACAACCGGTTAAAAAAAATTAAAAAATTTTAAAAAAGGAAAAAAAAACCAAATCAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGACAGTTGCTACTCCTGCTT