ORFeome > ptcd2 ORF1 – XORFeome v1.0

ptcd2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ptcd2
Gene ID: 985817
Gene Page ID: 985813
ORF Xenbase ID: 17291541

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129589
Original XGC clone length: 1149

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ837806
dbEST ID: 79655508
Trimmed Sequence: ATGGCGGTGCTGGGGTCCTGGACTGCCCAGCGGTGTCTTTGGGAGAATGGTGGTCGGTCGTTACTCCGAGCTGTGGCCCAGTCGGGTCCGTGCTGCAGCCACCAAGCTAAGCGTTACCTGTTAACTGACGATATCTTGAAACTGCATGAATTTCAAAAGAAGAAACTGGCTACTTTATATCAGATTTATGGGAAAAAAGATCTGTATTTTCAAATGATAGAAGATAAGCTACAGCGAAATGGAATCATCCTACGAGATGAGCTAAAAACACTACTTCACCTATGTAGCACTCAGCCTGATGTGGAATTTGCAAAGAGGGTTATATATAGGTACCATGCAGAAAATAAAAATGTAATGTTTGGCGAATTCCGATTTGGACCTGTTTTTCTTCGACTGTGTTATGAACTTGATCTTGAAGATATTGCCCTTGACCTTTTAAAAGACCAGACTCTACGTGGTTTTTTTTCTGACTGCACCTCCTTTAATATATTGATGGACATGCTCTTCACTAAAGGCCAGTATGAAAGAGCGGTGGAAGTGTTAGTGGAAATGCGAAATCAGAGGGTGAGGTTTAGCAGAGATACCTACATTTTGGCATTTGCTGTATGTTACAAGCTGAACAACCCCAATTCCTGGTAAATCTGTACCACTCTCCTAAAAGAAATCGAAATGACCGGAGATCTGCTCCCAAAACAAGCCGCCCTGCTTTGCTGCGGCTTTTTGCCTTTAAACCGAATGGATTTTCAAAAGAACCCGGGAAAATTTATTTCTAAAATCCTTGAAAAATTGGAATACCAAAACTTGGGTATATAAATTTTAATTTCTTTTC
Full Trace Sequence: GGGGGCCCCAATAAGTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGCTGGGGTCCTGGACTGCCCAGCGGTGTCTTTGGGAGAATGGTGGTCGGTCGTTACTCCGAGCTGTGGCCCAGTCGGGTCCGTGCTGCAGCCACCAAGCTAAGCGTTACCTGTTAACTGACGATATCTTGAAACTGCATGAATTTCAAAAGAAGAAACTGGCTACTTTATATCAGATTTATGGGAAAAAAGATCTGTATTTTCAAATGATAGAAGATAAGCTACAGCGAAATGGAATCATCCTACGAGATGAGCTAAAAACACTACTTCACCTATGTAGCACTCAGCCTGATGTGGAATTTGCAAAGAGGGTTATATATAGGTACCATGCAGAAAATAAAAATGTAATGTTTGGCGAATTCCGATTTGGACCTGTTTTTCTTCGACTGTGTTATGAACTTGATCTTGAAGATATTGCCCTTGACCTTTTAAAAGACCAGACTCTACGTGGTTTTTTTTCTGACTGCACCTCCTTTAATATATTGATGGACATGCTCTTCACTAAAGGCCAGTATGAAAGAGCGGTGGAAGTGTTAGTGGAAATGCGAAATCAGAGGGTGAGGTTTAGCAGAGATACCTACATTTTGGCATTTGCTGTATGTTACAAGCTGAACAACCCCAATTCCTGGTAAATCTGTACCACTCTCCTAAAAGAAATCGAAATGACCGGAGATCTGCTCCCAAAACAAGCCGCCCTGCTTTGCTGCGGCTTTTTGCCTTTAAACCGAATGGATTTTCAAAAGAACCCGGGAAAATTTATTTCTAAAATCCTTGAAAAATTGGAATACCAAAACTTGGGTATATAAATTTTAATTTCTTTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGCTGGGGTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837805
dbEST ID: 79655507
Trimmed Sequence: CTCCACCAATAGTGTAGACTGTAGAGATCGAAATGTCCTGTGGCTGATTTTCCTATTTCTTAGTAAATGCGCGTTGGTGTGTCTCAGTTCAGGAGAAGTATAACACAGCATTTGATCCAGAGTTAATGCACTTATTTGCCCTTCATTTTTCAGTCTCTGATAAACACTGTTAAATCTTGTGTGAAGTTCAGCCTGAGATTTCAGCTTCTGCCCAGCGGAGGCCAACACCTCCTCAGAAAATTCAAGTTTCTTCACAAGTATAGAGCCTGTGGTTCCAGTTGCAGCTTCCAGAAAATGTAGAACATCTTCCATTGTACTAGTGTGCACCTTAATGAGAAGAAGTAAATTATTACACAGTTTGGTATCAGTATTCATGATTTTAGAATAAATTGTCCTGGCTCTCTGAAATTCATTCTGTTTTAAGGCAAAAGCCGCAGCAAAGCAGGCCGCTTGCTTTGGGAGCAGATCTCCCGTCATCTCGATTTCTTCTAGGAGAGTTGTACAGATTTTACAGGAATTGGGGTTGTTCAGCTTGTAACATACAGCAAATGCCAAAATGTAGGTATCTTTGCTAAACCTCACCCTCTGATTTCGCATTTCCACTAACACTTCCACCGCTCTTTCATACTGGCCTTTAGTGAAGAGCATGTCCATCAATATATTAAAAGAGGTGCAGTCAGAAAAAAAACCACGTAGAGTCTGGTCTGTTTAAAGGTAAGGGGAATATCTTCAAGATCAAGTTCATAAACACAGTCAAGAAAAAACAGGTCCAAATCGGAATTCGCAAACATTACATTTTTATTTTCTGCATGGTGACTAGGTGTAAACCTCTTTGCAAAATCCAGAACAAGGTGAAATGGTACATAGGTAAAGTAATGTTTTAAGGCTCACCTTCGAAGAAAAGATCCAAATTTCCCTTCAACTTATTTTCCTATCATTTAAAAAAAAAAGATTTTTTTCCCCATAAAACCTAAAATAAAAATACCCAAGTTTCTTCCTTTTGGAAATTCTTTGCATTTTTCAGAATTTCGGGCAGTTTAAACAAGAAAAAGCTAAAACTTTGGGGGGGGGGCGGCGGGGGAGGCGGAAGCTGGGGGCACAAAGACTTGGGAAGTGAAGAAACAACAACCACCAAAATTACCTTCCCCCACACACACCCCCACCCCTGGAACCACGCTTCCACGGAACACCCCCCAGCCAAACCCCCGCACGCGACCGGGAGGGGGCGC
Full Trace Sequence: GGCCGGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCACCAATAGTGTAGACTGTAGAGATCGAAATGTCCTGTGGCTGATTTTCCTATTTCTTAGTAAATGCGCGTTGGTGTGTCTCAGTTCAGGAGAAGTATAACACAGCATTTGATCCAGAGTTAATGCACTTATTTGCCCTTCATTTTTCAGTCTCTGATAAACACTGTTAAATCTTGTGTGAAGTTCAGCCTGAGATTTCAGCTTCTGCCCAGCGGAGGCCAACACCTCCTCAGAAAATTCAAGTTTCTTCACAAGTATAGAGCCTGTGGTTCCAGTTGCAGCTTCCAGAAAATGTAGAACATCTTCCATTGTACTAGTGTGCACCTTAATGAGAAGAAGTAAATTATTACACAGTTTGGTATCAGTATTCATGATTTTAGAATAAATTGTCCTGGCTCTCTGAAATTCATTCTGTTTTAAGGCAAAAGCCGCAGCAAAGCAGGCCGCTTGCTTTGGGAGCAGATCTCCCGTCATCTCGATTTCTTCTAGGAGAGTTGTACAGATTTTACAGGAATTGGGGTTGTTCAGCTTGTAACATACAGCAAATGCCAAAATGTAGGTATCTTTGCTAAACCTCACCCTCTGATTTCGCATTTCCACTAACACTTCCACCGCTCTTTCATACTGGCCTTTAGTGAAGAGCATGTCCATCAATATATTAAAAGAGGTGCAGTCAGAAAAAAAACCACGTAGAGTCTGGTCTGTTTAAAGGTAAGGGGAATATCTTCAAGATCAAGTTCATAAACACAGTCAAGAAAAAACAGGTCCAAATCGGAATTCGCAAACATTACATTTTTATTTTCTGCATGGTGACTAGGTGTAAACCTCTTTGCAAAATCCAGAACAAGGTGAAATGGTACATAGGTAAAGTAATGTTTTAAGGCTCACCTTCGAAGAAAAGATCCAAATTTCCCTTCAACTTATTTTCCTATCATTTAAAAAAAAAAGATTTTTTTCCCCATAAAACCTAAAATAAAAATACCCAAGTTTCTTCCTTTTGGAAATTCTTTGCATTTTTCAGAATTTCGGGCAGTTTAAACAAGAAAAAGCTAAAACTTTGGGGGGGGGGCGGCGGGGGAGGCGGAAGCTGGGGGCACAAAGACTTGGGAAGTGAAGAAACAACAACCACCAAAATTACCTTCCCCCACACACACCCCCACCCCTGGAACCACGCTTCCACGGAACACCCCCCAGCCAAACCCCCGCACGCGACCGGGAGGGGGCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCACCAATAGTGTAGACTGTA