ORFeome > qsox1 ORF1 – XORFeome v1.0

qsox1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: qsox1
Gene ID: 944885
Gene Page ID: 944880
ORF Xenbase ID: 17291943

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC127418
Original XGC clone length: 2148

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ837475
dbEST ID: 79655177
Trimmed Sequence: ATGGGATTCAGCAGCAGCTTGTGCATCTGTGGCGCGACGCTTGTCCTGCTGCTGCTGACTTCTGTGGCCCCTTCCCAGGCTGCTCTCTACTCCCCGGATGAGCCCGTGGTGTTTCTTGACACAAAGGCCAGATCGTATTTGTTGGAATCCCGCAGTTTTTGGCTGGCAGAATTCTACGCCTCATGGTGTGGCCACTGTCAGAATTTTAAACCAACATGGAGCGCTCTGGCCGAAGATATCAAGGACTGGAGACCAGTGGTTTATTTGGGGGTGATCGACTGTGCTGAGGCATCCAACTCTGATACATGTACTGAATTTGGAGTTAAAGGATATCCTACTGTAAAGTCCTTCAAACCCTTTACAAAAGAAATTTCAGAAGGTGTCGAAGAGAAAGATCATACTATCCAGGCGCTGAGGGAAACCATCATTAAAAGACTAGAGGAACAAAAGGATTCTAGACCCCCTGCATGCCCCCCTTTGGAGCCAATCAGCGCATATGAAGTTGAACAGTTCTTCATAACACACCAAGAAGATTACTTGGCACTGATATTTGAGGAAGCTTCAATGTACATAGGAAGAGAGACAGCGTTGGATATGGTACAGTATGAAGGTGTCTCCGTGCGCAGAGTCCATCGTGATCAGGATGACATAGTGAACAAATTCCAGATTCCTTCTTTTCCAGCTCTTTGTCTGCTCTGTAAAAATGATCCCACCCTTATGTTAATATGGTAAAAAATACTCGCTCTTCATATACCAACTTTCCTGCGTTTCCCTCCCTGGGGAGTGAAGGAAAGGGAAAATCTCCCCCAATCCTTTG
Full Trace Sequence: GGGGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGATTCAGCAGCAGCTTGTGCATCTGTGGCGCGACGCTTGTCCTGCTGCTGCTGACTTCTGTGGCCCCTTCCCAGGCTGCTCTCTACTCCCCGGATGAGCCCGTGGTGTTTCTTGACACAAAGGCCAGATCGTATTTGTTGGAATCCCGCAGTTTTTGGCTGGCAGAATTCTACGCCTCATGGTGTGGCCACTGTCAGAATTTTAAACCAACATGGAGCGCTCTGGCCGAAGATATCAAGGACTGGAGACCAGTGGTTTATTTGGGGGTGATCGACTGTGCTGAGGCATCCAACTCTGATACATGTACTGAATTTGGAGTTAAAGGATATCCTACTGTAAAGTCCTTCAAACCCTTTACAAAAGAAATTTCAGAAGGTGTCGAAGAGAAAGATCATACTATCCAGGCGCTGAGGGAAACCATCATTAAAAGACTAGAGGAACAAAAGGATTCTAGACCCCCTGCATGCCCCCCTTTGGAGCCAATCAGCGCATATGAAGTTGAACAGTTCTTCATAACACACCAAGAAGATTACTTGGCACTGATATTTGAGGAAGCTTCAATGTACATAGGAAGAGAGACAGCGTTGGATATGGTACAGTATGAAGGTGTCTCCGTGCGCAGAGTCCATCGTGATCAGGATGACATAGTGAACAAATTCCAGATTCCTTCTTTTCCAGCTCTTTGTCTGCTCTGTAAAAATGATCCCACCCTTATGTTAATATGGTAAAAAATACTCGCTCTTCATATACCAACTTTCCTGCGTTTCCCTCCCTGGGGAGTGAAGGAAAGGGAAAATCTCCCCCAATCCTTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGATTCAGCAGCAGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837474
dbEST ID: 79655176
Trimmed Sequence: TGGGTAGAAAGTTCGCTGCCGAAGGCAACGTTTCCGAAGGCTCATGTATAGGTACATGCAGAGCAAGCACATACTGGAAAGAAAATAGAATACCACACATAGGCTTATGTCCAGGCGAGAAAATCCCAATTCCAGCGTCTTACCCCAGCGTAAATTTCCCTTTTCAGCTCCAACATTAATGTAGCTGTTCCCATCAATGCCCCTTCTCAACAGCCGTTTTCTCACTGCAATGTGGTCGAATTCCTCTTCAGGGATATCAAGGAGTATCTGAGGCATGATGGCACCGTCACTGTCATGCTCAACGGACCCCTGCAGAGATCTGCTAGGCAATAAACTGCGCAAAAAGGAGTTGGCTTCACCAGCATTCTTTTCCTCCTCTACTTTTACATGGACTGGAACATCTGCATCTGGATTGTTTTCATTTTTATTATCTTCTGTAATTAGTGATGGATATCTTAGCTTGAATGGGCTTTCATTCTTTTCCTTGCTGGTTTCTATTTTCTTAGTGACATTCCTCTGCCTTTCCNAGAGCACCTCCTCATCCTCCAGATAATCACTTGCCAAGTTTTCCCTTGAATAATGAGCCTTCATAAAGGTCAGAACATTTTGGGGAGGTCCCAGCCAGCTCATCAGCACCATCCTCCCTTGACATAAGGGGACAAGTGCTTTTGATGGCCCGGGGAAGTTTTGGAAATTCTGGAATCTCCCTTTGTTGCCCCGGGAAGGCCTTTTTTTTAACCCCAAAAAATGGCCCGGTCCCCCA
Full Trace Sequence: AAAACGTCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGGTAGAAAGTTCGCTGCCGAAGGCAACGTTTCCGAAGGCTCATGTATAGGTACATGCAGAGCAAGCACATACTGGAAAGAAAATAGAATACCACACATAGGCTTATGTCCAGGCGAGAAAATCCCAATTCCAGCGTCTTACCCCAGCGTAAATTTCCCTTTTCAGCTCCAACATTAATGTAGCTGTTCCCATCAATGCCCCTTCTCAACAGCCGTTTTCTCACTGCAATGTGGTCGAATTCCTCTTCAGGGATATCAAGGAGTATCTGAGGCATGATGGCACCGTCACTGTCATGCTCAACGGACCCCTGCAGAGATCTGCTAGGCAATAAACTGCGCAAAAAGGAGTTGGCTTCACCAGCATTCTTTTCCTCCTCTACTTTTACATGGACTGGAACATCTGCATCTGGATTGTTTTCATTTTTATTATCTTCTGTAATTAGTGATGGATATCTTAGCTTGAATGGGCTTTCATTCTTTTCCTTGCTGGTTTCTATTTTCTTAGTGACATTCCTCTGCCTTTCCNAGAGCACCTCCTCATCCTCCAGATAATCACTTGCCAAGTTTTCCCTTGAATAATGAGCCTTCATAAAGGTCAGAACATTTTGGGGAGGTCCCAGCCAGCTCATCAGCACCATCCTCCCTTGACATAAGGGGACAAGTGCTTTTGATGGCCCGGGGAAGTTTTGGAAATTCTGGAATCTCCCTTTGTTGCCCCGGGAAGGCCTTTTTTTTAACCCCAAAAAATGGCCCGGTCCCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGGTAGAAAGTTCGCTG