ORFeome > rab1a ORF1 – XORFeome v1.0

rab1a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rab1a
Gene ID: 865532
Gene Page ID: 485526
ORF Xenbase ID: 17292051

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045014
Original XGC clone length: 615

Human orthology & disease relationships

NCBI Entrez ID: 5861
Ensembl gene IDs: ENSG00000138069
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 208000,307030,601382

Library Location

Plate ID: GDExl11013
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ824125
dbEST ID: 79641827
Trimmed Sequence: 0
Full Trace Sequence: CCAATAATGATTTTATTTTGACTGATAGTGACCCGTTCTTTGGGCCAATTGAGTATTCCTGGCTTTTCTGGACGCCGTCTTTGTTCACAGATGTGGCAGCCATGTCCAGCATGAATCCCGAGTATGACTATTTATTCAAATTACTTTTGATTGGAGACTCTGGTGTGGGAAAGTCTTGTCTTCTGCTTAGGTTTGCAGATGACACATACACAGAAAGTTACATCAGTACAATTGGTGTTGATTTTAAAATCAGGACTATAGAGTTAGATGGAAAAACAATCAAACTGCAAATTTGGGACACTGCCGGCCAGGAAAGATTTCGAACCATTACATCAAGTTACTACAGGGGAGCCCACGGCATCATTGTTGTGTATGACGTAACAGACCAGGAATCCTTCAACAATGTCAAGCAGTGGCTTCAGGAAATAGATCGTTATGCCAGTGAGAACGTTAACAAGTTATTGGTAGGCAACAAATGTGATCTCACAACAAAGAAAGTTGTGGACTACACAACAGCAAAGGAGTTTGCAGACTCTCTGGGAATTCCATTTTTGGAAACAAGCGCAAAGAACGCGACAAACGTAGAGCAGGCCTTCATGACAATGGCAGCGGAGATCAAAAAGCGAATGGGCCCTGGCGCCACAGCAGGCGGTCAAGAGAAGAACGTCAAAATCCAGAGCACTCCAGTCAAGCAGTCTAGTGGAGGATGCTGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCACCGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTTATGTTGAGTCGAATTACATGGGTCATAACTTTTTCCCTGGACCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAGCATGAATCCCGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829432
dbEST ID: 79647134
Trimmed Sequence: GCAGCATCCTCCACTAGACTGCTTGACTGGAGTGCTCTGGATTTTGACGTTCTTCTCTTGACCGCCTGCTGTGGCGCCAGGGCCCATTCGCTTTTTGATCTCCGCTGCCATTGTCATGAAGGCCTGCTCTACGTTTGTCGCGTTCTTTGCGCTTGTTTCCAAAAATGGAATTCCCAGAGAGTCTGCAAACTCCTTTGCTGTTGTGTAGTCCACAACTTTCTTTGTTGTGAGATCACATTTGTTGCCTACCAATAACTTGTTAACGTTCTCACTGGCATAACGATCTATTTCCTGAAGCCACTGCTTGACATTGTTGAAGGATTCCTGGTCTGTTACGTCATACACAACAATGATGCCGTGGGCTCCCCTGTAGTAACTTGATGTAATGGTTCGAAATCTTTCCTGGCCGGCAGTGTCCCAGATTTGCAGTTTGATTGTTTTTCCATCTAACTCTATAGTCCTGATTTTAAAATCAACACCAATTGTACTGATGTAACTTTCTGTGTATGTGTCATCTGCAAACCTAAACAGAAGACCAGACTTTTCCCACCCAGAGTCCTCCAATAAAAAGTAATTTTGAATAAAATGCTCATATTCCGGGAATTATTGCGGGAACTGGGTGCCAACTTTTTTTGGACCAAGTGTGGCGATTATTAAAAACCATTTGTTCATCAATTTTGGTTTCAACCGAAAAGGGGTCCACTATCAAGACAAAAAAAAAAATTCAAATAATTTGGGGGGGCCGCAGACCTTTAAAAAAACTGGGGTCGGC
Full Trace Sequence: CCGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGAGTTGTACGTTCGGGACTGGGAAGAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAGCATCCTCCACTAGACTGCTTGACTGGAGTGCTCTGGATTTTGACGTTCTTCTCTTGACCGCCTGCTGTGGCGCCAGGGCCCATTCGCTTTTTGATCTCCGCTGCCATTGTCATGAAGGCCTGCTCTACGTTTGTCGCGTTCTTTGCGCTTGTTTCCAAAAATGGAATTCCCAGAGAGTCTGCAAACTCCTTTGCTGTTGTGTAGTCCACAACTTTCTTTGTTGTGAGATCACATTTGTTGCCTACCAATAACTTGTTAACGTTCTCACTGGCATAACGATCTATTTCCTGAAGCCACTGCTTGACATTGTTGAAGGATTCCTGGTCTGTTACGTCATACACAACAATGATGCCGTGGGCTCCCCTGTAGTAACTTGATGTAATGGTTCGAAATCTTTCCTGGCCGGCAGTGTCCCAGATTTGCAGTTTGATTGTTTTTCCATCTAACTCTATAGTCCTGATTTTAAAATCAACACCAATTGTACTGATGTAACTTTCTGTGTATGTGTCATCTGCAAACCTAAACAGAAGACCAGACTTTTCCCACCCAGAGTCCTCCAATAAAAAGTAATTTTGAATAAAATGCTCATATTCCGGGAATTATTGCGGGAACTGGGTGCCAACTTTTTTTGGACCAAGTGTGGCGATTATTAAAAACCATTTGTTCATCAATTTTGGTTTCAACCGAAAAGGGGTCCACTATCAAGACAAAAAAAAAAATTCAAATAATTTGGGGGGGCCGCAGACCTTTAAAAAAACTGGGGTCGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGCATCCTCCACTAGACTGCTT