ORFeome > rab33b ORF1 – XORFeome v1.0

rab33b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rab33b
Gene ID: 866052
Gene Page ID: 491300
ORF Xenbase ID: 17292147

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059345
Original XGC clone length: 681

Human orthology & disease relationships

NCBI Entrez ID: 83452
Ensembl gene IDs: ENSG00000172007
Directly associated (OMIM) disease MIM numbers: 615222
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ824752
dbEST ID: 79642454
Trimmed Sequence: ATGTCAGCAGGCTCGGGTGGTGATGGAGGCTTGGAGTCCTCGCTGGAGGCGAGTATAAGCAGCTCTTGTTCGTTTGGTGTGACCCGTGCCAGGATTTTTAAGATCATTGTAATTGGGGATTCAAATGTCGGAAAAACTTGTCTGACTTACCGATTTTGCACCAGTTGCTTTCCGGAAAGGACAGAAGCTACAATAGGGGTGGACTTTCGAGAAAGAACTGTGGACATAGACGGGGAGAGGATCAAGATTCAGCTATGGGACACTGCAGGACAGGAACGTTTCCGTAAGAGTATGGTGCACCATTACTACAGGAATGTGCATGCTGTAGTCTTTGTCTATGATATCACCAATATGGCCAGTTTTCAGAGTTTACCTGCCTGGATTGAGGAGTGCAAACAGCACCTAATATCCAATGATGTGCCCCGTATCTTGGTTGGTAATAAATGTGACTTGCTAGCCTGTATCCAGGTTCCCACGGACATGGCTCAGAAGTTCGCCGACTCGCACAGCATGCCCATGTTTGAAACATCAGCCAAAAGAACAAATGACCACGTGGAAGCCATCTTCATGACGCTTGTTCACAAACTCAAAAGCCACAAGCCACTGACTTTGAGCCAGCCTCCTGATAGTACAGTGGAGTTGAAATCANGTCCAAAGACTTTGTTTCCATGTGGGCTGCTGCGCA
Full Trace Sequence: TATTGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGCAGGCTCGGGTGGTGATGGAGGCTTGGAGTCCTCGCTGGAGGCGAGTATAAGCAGCTCTTGTTCGTTTGGTGTGACCCGTGCCAGGATTTTTAAGATCATTGTAATTGGGGATTCAAATGTCGGAAAAACTTGTCTGACTTACCGATTTTGCACCAGTTGCTTTCCGGAAAGGACAGAAGCTACAATAGGGGTGGACTTTCGAGAAAGAACTGTGGACATAGACGGGGAGAGGATCAAGATTCAGCTATGGGACACTGCAGGACAGGAACGTTTCCGTAAGAGTATGGTGCACCATTACTACAGGAATGTGCATGCTGTAGTCTTTGTCTATGATATCACCAATATGGCCAGTTTTCAGAGTTTACCTGCCTGGATTGAGGAGTGCAAACAGCACCTAATATCCAATGATGTGCCCCGTATCTTGGTTGGTAATAAATGTGACTTGCTAGCCTGTATCCAGGTTCCCACGGACATGGCTCAGAAGTTCGCCGACTCGCACAGCATGCCCATGTTTGAAACATCAGCCAAAAGAACAAATGACCACGTGGAAGCCATCTTCATGACGCTTGTTCACAAACTCAAAAGCCACAAGCCACTGACTTTGAGCCAGCCTCCTGATAGTACAGTGGAGTTGAAATCANGTCCAAAGACTTTGTTTCCATGTGGGCTGCTGCGCAACTTCCTGGTACAAAATTTGGCATATTAAGAAAGCATTGGTTATTCAATTTGTTGCAACCAAACAGGCACTATTCGTCAAAATAAAATCCTTATTTTTCCCCCCCGGCTGAATCCCCCCCCACAAGGGGGGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGCAGGCTCGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ830104
dbEST ID: 79647806
Trimmed Sequence: GCAGCCACATGGAAACAAAGTCTTTGGACCTGAATTCAACTCCACTGTACTATCAGGAGGCTGGCTCAAAGTCAGTGGCTTGTGGCTTTTGAGTTTGTGAACAAGCGTCATGAAGATGGCTTCCACGTGGTCATTTGTTCTTTTGGCTGATGTTTCAAACATGGGCATGCTGTGCGAGTCGGCGAACTTCTGAGCCATGTCCGTGGGAACCTGGATACAGGCTAGCAAGTCACATTTATTACCAACCAAGATACGGGGCACATCATTGGATATTAGGTGCTGTTTGCACTCCTCAATCCAGGCAGGTAAACTCTGAAAACTGGCCATATTGGTGATATCATAGACAAAGACTACAGCATGCACATTCCTGTAGTAATGGTGCACCATACTCTTACGGAAACGTTCCTGTCCTGCAGTGTCCCATAGCTGAATCTTGATCCTCTCCCCGTCTATGTCCACAGTTCTTTCTCGAAAGTCCACCCCTATTGTAGCTTCTGTCCTTTCCGGAAAGCAACTGGTGCAAAATCGGTAAGTCAGACCAGTTTTTCCGACATTTGAATCCCCAATTACAATGATCTTAAAAAATCCTGGCACGGGTCACACCAAACCAAACAAGAGCTGCTTATACTCGCCTCCAGCGAGGACTCCAAGCCTCCCTCACCACCCGAGCCTGCTGAACTGGTGCCCACTTTTTTGGAAACAAAGTGGGCATTAAAAAAAAAAAACTTTGTCTTCATCACAATTTTGTTTTCAAAACAAA
Full Trace Sequence: GGACAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAGCCACATGGAAACAAAGTCTTTGGACCTGAATTCAACTCCACTGTACTATCAGGAGGCTGGCTCAAAGTCAGTGGCTTGTGGCTTTTGAGTTTGTGAACAAGCGTCATGAAGATGGCTTCCACGTGGTCATTTGTTCTTTTGGCTGATGTTTCAAACATGGGCATGCTGTGCGAGTCGGCGAACTTCTGAGCCATGTCCGTGGGAACCTGGATACAGGCTAGCAAGTCACATTTATTACCAACCAAGATACGGGGCACATCATTGGATATTAGGTGCTGTTTGCACTCCTCAATCCAGGCAGGTAAACTCTGAAAACTGGCCATATTGGTGATATCATAGACAAAGACTACAGCATGCACATTCCTGTAGTAATGGTGCACCATACTCTTACGGAAACGTTCCTGTCCTGCAGTGTCCCATAGCTGAATCTTGATCCTCTCCCCGTCTATGTCCACAGTTCTTTCTCGAAAGTCCACCCCTATTGTAGCTTCTGTCCTTTCCGGAAAGCAACTGGTGCAAAATCGGTAAGTCAGACCAGTTTTTCCGACATTTGAATCCCCAATTACAATGATCTTAAAAAATCCTGGCACGGGTCACACCAAACCAAACAAGAGCTGCTTATACTCGCCTCCAGCGAGGACTCCAAGCCTCCCTCACCACCCGAGCCTGCTGAACTGGTGCCCACTTTTTTGGAAACAAAGTGGGCATTAAAAAAAAAAAACTTTGTCTTCATCACAATTTTGTTTTCAAAACAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGCCACATGGAAACAA