ORFeome > rapgef5 ORF1 – XORFeome v1.0

rapgef5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rapgef5
Gene ID: 6252805
Gene Page ID: 876512
ORF Xenbase ID: 17292537

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123126
Original XGC clone length: 819

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ838026
dbEST ID: 79655728
Trimmed Sequence: ATGACTGTGGGGCAGGTGAGGAGGAAGATGCAGCCTACGTCGGATTGTAGTGGCCCCATCAGCTTGTCCCCAGCAGCACCAGGGATTCCTTCTCTCAGCCGGACTCGCAGTGTTCGGGAGCCGCAGGCGCAGCTGAAGCACAAGCTCAGGGAACTGCCATCCCTACTGAAGAGCGGCCTGACCCTGCGGAGACGGAGTTCTGTGCTTGGCCCCTCACCCTCGTTATGTGAAGGCGACGACGCGGCTGTAGCTGGAAACACGAGCAGCCCGATTCTTCCTGAAAGAATTCCAAGCCTGTATGTGGATAATTCAGCCACCAAGCTTTATGGTGAAAGTGTATCTTGTGCAGGAAGAGCTCTGAGAAATGCAGTGAGAAGCCAAACACCTGAACTGATTAGAGATCGCATGTATCTGACGTGTATTTGCAGAAAAAGTTGTGTGGGGTCTGAACTGGTGGATTGGTTGCTGCAGCATTGCCCCTTTGTGCAGTGTCGATATACTGCAGCTAGTATCTGGCAGATATTATTGAAACTTGGGATCCTACTATCAGTGGACAAACAACCTATTTTTCCCAGACGCATATGTGTTCTACCAATTTTCTTCTTAAAATTGTGGAAATGCTGCCTGTGAATTTGGCAAGAAAAAGGATGGTTCGGGGGTGTCAAACTTTTAAAGCACCTTGTCCCTCCCGTCCCCCTTTCATTCCACATTGTTTGATTGGTCGGCTTGGAAAGGTTAGATCATTTCAAATAAAGCAAAAAAACAAGAAACCTGTCCCAAATTAAAACACCCTTTGCCCCCCTCCCCCCTTTCCTCC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTGTGGGGCAGGTGAGGAGGAAGATGCAGCCTACGTCGGATTGTAGTGGCCCCATCAGCTTGTCCCCAGCAGCACCAGGGATTCCTTCTCTCAGCCGGACTCGCAGTGTTCGGGAGCCGCAGGCGCAGCTGAAGCACAAGCTCAGGGAACTGCCATCCCTACTGAAGAGCGGCCTGACCCTGCGGAGACGGAGTTCTGTGCTTGGCCCCTCACCCTCGTTATGTGAAGGCGACGACGCGGCTGTAGCTGGAAACACGAGCAGCCCGATTCTTCCTGAAAGAATTCCAAGCCTGTATGTGGATAATTCAGCCACCAAGCTTTATGGTGAAAGTGTATCTTGTGCAGGAAGAGCTCTGAGAAATGCAGTGAGAAGCCAAACACCTGAACTGATTAGAGATCGCATGTATCTGACGTGTATTTGCAGAAAAAGTTGTGTGGGGTCTGAACTGGTGGATTGGTTGCTGCAGCATTGCCCCTTTGTGCAGTGTCGATATACTGCAGCTAGTATCTGGCAGATATTATTGAAACTTGGGATCCTACTATCAGTGGACAAACAACCTATTTTTCCCAGACGCATATGTGTTCTACCAATTTTCTTCTTAAAATTGTGGAAATGCTGCCTGTGAATTTGGCAAGAAAAAGGATGGTTCGGGGGTGTCAAACTTTTAAAGCACCTTGTCCCTCCCGTCCCCCTTTCATTCCACATTGTTTGATTGGTCGGCTTGGAAAGGTTAGATCATTTCAAATAAAGCAAAAAAACAAGAAACCTGTCCCAAATTAAAACACCCTTTGCCCCCCTCCCCCCTTTCCTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTGTGGGGCAGGTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838025
dbEST ID: 79655727
Trimmed Sequence: AGGGGAAAAAATTACCGCAGAAGTGAGACGGGCAAGTGCTTGAATTTGCAGGATTTTGTTATTTGCTTCATTTGAATGATCTAGCTTCTCAGCTGACACATCACACATGTTTGATGTAAGAGGGACGAGAGGGACAAGTTGCTTTAAAAGTCTGACACCCATGAGCCATCCTTTTTCTCTGCCAAATTCACAGGCAGCATTTCCACATTCTTCAGAAGAAAATTGGTAGAACACATATGCGTCTTGGAAACATAGTTGTTTGTCCACTGATAGTAGGATCCCAAGTTTCAATAATATCTGCCAGATACTAGCTGCAGTATATCGACACTGCACAAAGGGGCGATGCTGCAGCAACCAATCCACCAGTTCAGACCCCACACAACTTTTTCTGCAAAGACACGTCAGATACATGCCATCTCTAATCAGTTCAGGTGGTTTGGCTTGCTCCTGCATTTCTCAGAGCTCTTCCTGCACAAGAAACACTTTCACCATAAAGATTGGTGGGGGGAGGATCCACATACAAGCTTGGGATTTCGTTCATGAGAAATCAGACTGGCTGTGGTTTCCGCTAACGGCGCGTCGGTGGCCTTCCATAACCAAAGATAAGGGGGCGGGGCCGAAAACCCCATCTCCCCGGGGTCGGGGGGCGCTTGCCTTCCAAATAGGCAAGTCCCTGACGCGGGGGCTTTGGGGGGCGCCCGCCGCCCCCCGGGGGCCTCCCATTGCCACTTCGGAAAAAAAGGGGGCCAAAGAGGGCGGGGGGGGGGGGG
Full Trace Sequence: GAAAGGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGGGAAAAAATTACCGCAGAAGTGAGACGGGCAAGTGCTTGAATTTGCAGGATTTTGTTATTTGCTTCATTTGAATGATCTAGCTTCTCAGCTGACACATCACACATGTTTGATGTAAGAGGGACGAGAGGGACAAGTTGCTTTAAAAGTCTGACACCCATGAGCCATCCTTTTTCTCTGCCAAATTCACAGGCAGCATTTCCACATTCTTCAGAAGAAAATTGGTAGAACACATATGCGTCTTGGAAACATAGTTGTTTGTCCACTGATAGTAGGATCCCAAGTTTCAATAATATCTGCCAGATACTAGCTGCAGTATATCGACACTGCACAAAGGGGCGATGCTGCAGCAACCAATCCACCAGTTCAGACCCCACACAACTTTTTCTGCAAAGACACGTCAGATACATGCCATCTCTAATCAGTTCAGGTGGTTTGGCTTGCTCCTGCATTTCTCAGAGCTCTTCCTGCACAAGAAACACTTTCACCATAAAGATTGGTGGGGGGAGGATCCACATACAAGCTTGGGATTTCGTTCATGAGAAATCAGACTGGCTGTGGTTTCCGCTAACGGCGCGTCGGTGGCCTTCCATAACCAAAGATAAGGGGGCGGGGCCGAAAACCCCATCTCCCCGGGGTCGGGGGGCGCTTGCCTTCCAAATAGGCAAGTCCCTGACGCGGGGGCTTTGGGGGGCGCCCGCCGCCCCCCGGGGGCCTCCCATTGCCACTTCGGAAAAAAAGGGGGCCAAAGAGGGCGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGGGAAAAAATTACCGCAGA