ORFeome > rax ORF1 – XORFeome v1.0

rax ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rax
Gene ID: 866185
Gene Page ID: 492664
ORF Xenbase ID: 17292675

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123153
Original XGC clone length: 978

Human orthology & disease relationships

NCBI Entrez ID: 30062
Ensembl gene IDs: ENSG00000134438
Directly associated (OMIM) disease MIM numbers: 611038
Indirectly associated (Lage, et al.) disease MIM numbers: 106210,120200,120430,129750,136520,148190,165550,604229

Library Location

Plate ID: GDExl11087
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ838112
dbEST ID: 79655814
Trimmed Sequence: ATGCACCTGCACAGTCCTCCCCTGATGGCTGATGGAAGCTTCTCTCTGTCCGGACATCTGCTCAGGAGCCCAGGAGGTAACCCGTCGAGGCTGCACAGTATAGAGGCCATCTTAGGGTTTGCCAAAGAGGATAGTGTCCTGGGCTCATTTCAGTCTGAGGTCAGTCCAAGAAATGCCAAAGAGGTGGACAAGAGGAGCTCTAGACATTGTCTCCACAAAATGACAGAAGAGATTCATCCCCAACAGGAACATTTAGAAGATGGCCAGACTGGTGGCTATGGAGATCCATATTCAGCAAAGACCTCAAGCGAGTGCCTGAGCCCAGGCTTGTCCACCTCAAACAGTGACAATAAACTCTCTGACGATGAACAACAGCCCAAGAAGAAACACAGGAGGAACCGGACAACATTCACAACTTACCAACTGCACGAGCTGGAGAGGGCATTCGAGAAGTCCCACTACCCTGACGTGTACAGCAGAGAAGAGCTGGCTATGAAAGTCAATTTGCCTGAAGTCAGGGTGCAGGTATGGTTTCAGAACAGGAGAGCCAAATGGAGGAGGCAAGAGAAACTAGAGGTGACCTCCATGAAACTTCAAGATTCCCCGATGCTTTCATTTAACCGGTCTCCTCAACCTTCTGCCATGAGTGCCCTCAGCAGTAGTCTTCCTCTGGACTCCTGGCTCAACCCCACGTTTATCCATACACAGCCCCTGCCGAGTTTTAACAGGGTTCGTCACCACCCCCAACCAGCCCTTCAGCGCGGTTACCCCCCCCCCCCCCTTT
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCACCTGCACAGTCCTCCCCTGATGGCTGATGGAAGCTTCTCTCTGTCCGGACATCTGCTCAGGAGCCCAGGAGGTAACCCGTCGAGGCTGCACAGTATAGAGGCCATCTTAGGGTTTGCCAAAGAGGATAGTGTCCTGGGCTCATTTCAGTCTGAGGTCAGTCCAAGAAATGCCAAAGAGGTGGACAAGAGGAGCTCTAGACATTGTCTCCACAAAATGACAGAAGAGATTCATCCCCAACAGGAACATTTAGAAGATGGCCAGACTGGTGGCTATGGAGATCCATATTCAGCAAAGACCTCAAGCGAGTGCCTGAGCCCAGGCTTGTCCACCTCAAACAGTGACAATAAACTCTCTGACGATGAACAACAGCCCAAGAAGAAACACAGGAGGAACCGGACAACATTCACAACTTACCAACTGCACGAGCTGGAGAGGGCATTCGAGAAGTCCCACTACCCTGACGTGTACAGCAGAGAAGAGCTGGCTATGAAAGTCAATTTGCCTGAAGTCAGGGTGCAGGTATGGTTTCAGAACAGGAGAGCCAAATGGAGGAGGCAAGAGAAACTAGAGGTGACCTCCATGAAACTTCAAGATTCCCCGATGCTTTCATTTAACCGGTCTCCTCAACCTTCTGCCATGAGTGCCCTCAGCAGTAGTCTTCCTCTGGACTCCTGGCTCAACCCCACGTTTATCCATACACAGCCCCTGCCGAGTTTTAACAGGGTTCGTCACCACCCCCAACCAGCCCTTCAGCGCGGTTACCCCCCCCCCCCCCTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCACCTGCACAGTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ838111
dbEST ID: 79655813
Trimmed Sequence: TATGGTTTGCCAAGGCTTGCCGAAAGACTGGATGTGTTCCTTTGCTTTCATCCTCAGAGAGGCTATGCTGTTATTTCTGGGGTCTATTTCTTCCAGTGGATACTTGTCTACAAAGTTGGCCCCACACTGGTAAGGAGGAGGTGGACCCATGGCTCCTAAAGGTTGGAGAGCATGACCCATGGATGCAGGGTTTATAAATGGCGGTGGGGTGTAACTGCCTGGAAGGCTTGTCGGTGTGGTGACGAACCCTGGTAAACTCTGCAGGGCTGTGCTATTGGATAACGGTGGGGTGAGCCAGGAGTCCAGAGGAAGACTACTGCTGAGGGCACTCATGGCAGAAGGTTGAGGAGACCGGTTAAATGAAAGCATCGGGGAATCTTGAAGTTTCATGGAGGTCACCTCTAGTTTCTCTTGCCTCCTCCATTTGGCTCTCCTGTTCTGAAACCATACCTGCACCCTGACTTCAGGCAAATTGACTTTCATAGCCAGCTCTTCTCTGCTGTACACGTCAGGGTAGTGGGACTTCCGCAATGCCCTCTCCAGCTCTTGCACTTGGTAAGTTGTGAATGTTGTCCGGTTCCTCCCGGTGTTCTTCTTGGGCTGTTTGTTCTCCTTCAAAAATTTTATTGTCCTGTTTGGAGGGGGAACAAGCCCGGGGGTCCGGCCCTCGCTTTAAGGTTCTTTGTTGGAGTATGGATTTTGCATAAACCACCGAGTCCTAGCACACTTTCCAAAATTTTTTCCTTGTATGGGAGATAGAAGTGTGCTTGCTGGGTGGCG
Full Trace Sequence: GAAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATGGTTTGCCAAGGCTTGCCGAAAGACTGGATGTGTTCCTTTGCTTTCATCCTCAGAGAGGCTATGCTGTTATTTCTGGGGTCTATTTCTTCCAGTGGATACTTGTCTACAAAGTTGGCCCCACACTGGTAAGGAGGAGGTGGACCCATGGCTCCTAAAGGTTGGAGAGCATGACCCATGGATGCAGGGTTTATAAATGGCGGTGGGGTGTAACTGCCTGGAAGGCTTGTCGGTGTGGTGACGAACCCTGGTAAACTCTGCAGGGCTGTGCTATTGGATAACGGTGGGGTGAGCCAGGAGTCCAGAGGAAGACTACTGCTGAGGGCACTCATGGCAGAAGGTTGAGGAGACCGGTTAAATGAAAGCATCGGGGAATCTTGAAGTTTCATGGAGGTCACCTCTAGTTTCTCTTGCCTCCTCCATTTGGCTCTCCTGTTCTGAAACCATACCTGCACCCTGACTTCAGGCAAATTGACTTTCATAGCCAGCTCTTCTCTGCTGTACACGTCAGGGTAGTGGGACTTCCGCAATGCCCTCTCCAGCTCTTGCACTTGGTAAGTTGTGAATGTTGTCCGGTTCCTCCCGGTGTTCTTCTTGGGCTGTTTGTTCTCCTTCAAAAATTTTATTGTCCTGTTTGGAGGGGGAACAAGCCCGGGGGTCCGGCCCTCGCTTTAAGGTTCTTTGTTGGAGTATGGATTTTGCATAAACCACCGAGTCCTAGCACACTTTCCAAAATTTTTTCCTTGTATGGGAGATAGAAGTGTGCTTGCTGGGTGGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATGGTTTGCCAAGGCTTGCCGA