ORFeome > rcn1 ORF1 – XORFeome v1.0

rcn1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rcn1
Gene ID: 865955
Gene Page ID: 490300
ORF Xenbase ID: 17292987

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123245
Original XGC clone length: 969

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ838837
dbEST ID: 79656539
Trimmed Sequence: ATGGATCCCCATAGTGTCCTGTGCCTGATGCTGCTAGTCCTATGCACTGGAGAGATACTCTGCAAGCCCACCTTCCGAAAGGAGAGGATCCGACTGGACCCGGAACTCAACAGCCAGATCCACGAAGAGAACCAGAGCTTCCAACAGGACCACGAGGCTTTCCTGGGCAAAGATGAGGCCAAGACCTTTGATCAGCTCACAGCCGAAGAGAGCACAGACAGACTGGGAAAGATCGTTGATAGGATCGATAGCGATAGTGATGGGCTCGTTAACACAGAGGAGCTAACGGCATGGATCAAGCGAGTACAAAAAAGATACGTTTATGAGAATGTCGCGAGAGTCTGGAAAGACTACGACGTTAATAAAGACAATGCAATCTCTTGGGAAGAATACAAGCAAGCCACATATGGATATTACCTGGCCAACCCTGAAGAGTTCCAAGATGCGACCGAACAGTTCAGCTTCAAGAAGATGCTGCCCAGAGACGAAAGGAGGTTCAAACAAGCAGATCTCAATGGGGATTTAGCAGCAAACAGGGAAGAGTTCACTGCATTTCTCCACCCAAAGGAGTTTGAACATATGAAGGATATTGTGATATTGGAAACCCTGGAAGACATAGACAAGATTGAGGATGGGTTTTGTGGATCAGGATGAATTATATGGCGAAAATGTTTTTCCTTGAAAAAAGGTTGGCCCTGAACCTTGATTGGGTTTGCCCCCAAAAAGGGGAACAATTTTGCCAAATTTTTTAAGAACCCTTCCACAAGAAACTGGAAAAGAAAGGGATG
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATCCCCATAGTGTCCTGTGCCTGATGCTGCTAGTCCTATGCACTGGAGAGATACTCTGCAAGCCCACCTTCCGAAAGGAGAGGATCCGACTGGACCCGGAACTCAACAGCCAGATCCACGAAGAGAACCAGAGCTTCCAACAGGACCACGAGGCTTTCCTGGGCAAAGATGAGGCCAAGACCTTTGATCAGCTCACAGCCGAAGAGAGCACAGACAGACTGGGAAAGATCGTTGATAGGATCGATAGCGATAGTGATGGGCTCGTTAACACAGAGGAGCTAACGGCATGGATCAAGCGAGTACAAAAAAGATACGTTTATGAGAATGTCGCGAGAGTCTGGAAAGACTACGACGTTAATAAAGACAATGCAATCTCTTGGGAAGAATACAAGCAAGCCACATATGGATATTACCTGGCCAACCCTGAAGAGTTCCAAGATGCGACCGAACAGTTCAGCTTCAAGAAGATGCTGCCCAGAGACGAAAGGAGGTTCAAACAAGCAGATCTCAATGGGGATTTAGCAGCAAACAGGGAAGAGTTCACTGCATTTCTCCACCCAAAGGAGTTTGAACATATGAAGGATATTGTGATATTGGAAACCCTGGAAGACATAGACAAGATTGAGGATGGGTTTTGTGGATCAGGATGAATTATATGGCGAAAATGTTTTTCCTTGAAAAAAGGTTGGCCCTGAACCTTGATTGGGTTTGCCCCCAAAAAGGGGAACAATTTTGCCAAATTTTTTAAGAACCCTTCCACAAGAAACTGGAAAAGAAAGGGATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCCCCATAGTGTCCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838836
dbEST ID: 79656538
Trimmed Sequence: CAATTCATCGTGGTTCCTCGTGAGATCCTCTCCATAGTTGGTTGCCTGACTCCCCACAAACATGTTCCAGTTGTGCAATATTTCCTCCTTAGTCAGCAGCTTGTCCTTGTCCAGATCTGATTCATAGATTAGGTGTCTGGCTTCAGCTTGTGCGTGGTCATAGTCCTGTGGAAGAATCCAGTGCCTGATCTCCTCTTTATCCATCTTTCCATCTTTGTTGAGGTCTCTAAAATCTGCAAATTGTTCCCTTTCTGTGGCTACCCAGTCAGGCTCAGGGCCACCTTCTTCATGTGAAAACATGTCCGCAATATATTCATCTTGATCCACAAACCCATCCTCATTCTTGTCTATGTCTTCCAGGGTTTCCAATATCACAATATCCTTCATATGTTCAAACTCCTCTGGGTGGAGAAATGCAGTGAACTCTTCCCTGTTTGCTGCTAAATCCCCATTGAGATCTGCTTGTTTGAACCTCCTTTCGTCTCTGGGCAGCATCTTCTTGAAGCTGAACTGTTCGGTCGCATCTTGGAACTCTTCAGGGTTGGCCAGGTAATATCCATATGTGGCTTGCTTGTATTCTTCCCAAGAGATTGCATTGTCTTTAATAACGTCGTAATCTTTCCAGACTCTCGCGACATTCTCATAAACTTAATCTTTTTTGTACTCGCTTGATCCATGGCCGTTGCCTCCTCCTTTGTTAACCAAACCCAATCACTAACGCTTAATCAAAACCTAATCAA
Full Trace Sequence: AGCCAGTGGGTAATACGACTCACTATNAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAATTCATCGTGGTTCCTCGTGAGATCCTCTCCATAGTTGGTTGCCTGACTCCCCACAAACATGTTCCAGTTGTGCAATATTTCCTCCTTAGTCAGCAGCTTGTCCTTGTCCAGATCTGATTCATAGATTAGGTGTCTGGCTTCAGCTTGTGCGTGGTCATAGTCCTGTGGAAGAATCCAGTGCCTGATCTCCTCTTTATCCATCTTTCCATCTTTGTTGAGGTCTCTAAAATCTGCAAATTGTTCCCTTTCTGTGGCTACCCAGTCAGGCTCAGGGCCACCTTCTTCATGTGAAAACATGTCCGCAATATATTCATCTTGATCCACAAACCCATCCTCATTCTTGTCTATGTCTTCCAGGGTTTCCAATATCACAATATCCTTCATATGTTCAAACTCCTCTGGGTGGAGAAATGCAGTGAACTCTTCCCTGTTTGCTGCTAAATCCCCATTGAGATCTGCTTGTTTGAACCTCCTTTCGTCTCTGGGCAGCATCTTCTTGAAGCTGAACTGTTCGGTCGCATCTTGGAACTCTTCAGGGTTGGCCAGGTAATATCCATATGTGGCTTGCTTGTATTCTTCCCAAGAGATTGCATTGTCTTTAATAACGTCGTAATCTTTCCAGACTCTCGCGACATTCTCATAAACTTAATCTTTTTTGTACTCGCTTGATCCATGGCCGTTGCCTCCTCCTTTGTTAACCAAACCCAATCACTAACGCTTAATCAAAACCTAATCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAATTCATCGTGGTTCCTCGT