ORFeome > rnf112 ORF1 – XORFeome v1.0

rnf112 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rnf112
Gene ID: 920341
Gene Page ID: 920328
ORF Xenbase ID: 17293677

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108430
Original XGC clone length: 1839

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ837971
dbEST ID: 79655673
Trimmed Sequence: ATGGAGGGTCCCAGCCGGGCAGCGGCAGGAGAAAGAGGAGGCAGAAGGGGCAGCGCTGCTCAGTCACAGAACAGGAGAGGGAGAAGGAGGCAGAGAAAGCCAAAAAACACTCCAGAGGCCGGAGATTCAGGGACTTCATCCGGCAGTGCCCCGCACCCCCAATATGGAGCAGATTGTTTCTCTTCATTAACGGAGGATATTACCTGTTCCATCTGCCTGGACGACCTAACCGACCCTGTCTACATTACCTGCGGACACACTTTCTGCAGGAACTGCATCACTACCCATTGGGGCACCTCACAGGGATACCTTTGCCCGGAATGTCGGGCAGTGTGCCCTAGAAATCAAATAGTTCCTGACTACAGACTGGGAAATCTCATCTCCAAAATCAAGCAGGGTATAAAAAAGAGTGACGCAATGCAGGAGAATCTTACAGCTGCCGAACCGGATCATCCAATTCAATTGGTCTGGACGGATGTGAATGGTCGTCTGAGTTTAGATCTATCAGGTGCTCACGACTGCTTCCTAAATACGAGATACTCAAATTACCCGGTGTTCATTCTCTGCATCATTGGGGAGAACGGCGGGGGCAAATCCTTTCTGATGAACTATATAATGCGGGGCGCTGAGAACCATGGAAATGGATGAGGAAATCTCATTTGGGGGCAGATGATAAGCCCTTTGAAAGGTTCAAGTGGAATCCTTGGACTGGAAACCCCCACCAAGCGGTATCTGGGATGGTGAAACGGGGCCGTTCCGTTGGGAATCCATAAAGGGGGGGGAAAAAATGGGGGTCTTTTTTTACTGCAAATTCCTTAAGGGGCCGCGT
Full Trace Sequence: CGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGGTCCCAGCCGGGCAGCGGCAGGAGAAAGAGGAGGCAGAAGGGGCAGCGCTGCTCAGTCACAGAACAGGAGAGGGAGAAGGAGGCAGAGAAAGCCAAAAAACACTCCAGAGGCCGGAGATTCAGGGACTTCATCCGGCAGTGCCCCGCACCCCCAATATGGAGCAGATTGTTTCTCTTCATTAACGGAGGATATTACCTGTTCCATCTGCCTGGACGACCTAACCGACCCTGTCTACATTACCTGCGGACACACTTTCTGCAGGAACTGCATCACTACCCATTGGGGCACCTCACAGGGATACCTTTGCCCGGAATGTCGGGCAGTGTGCCCTAGAAATCAAATAGTTCCTGACTACAGACTGGGAAATCTCATCTCCAAAATCAAGCAGGGTATAAAAAAGAGTGACGCAATGCAGGAGAATCTTACAGCTGCCGAACCGGATCATCCAATTCAATTGGTCTGGACGGATGTGAATGGTCGTCTGAGTTTAGATCTATCAGGTGCTCACGACTGCTTCCTAAATACGAGATACTCAAATTACCCGGTGTTCATTCTCTGCATCATTGGGGAGAACGGCGGGGGCAAATCCTTTCTGATGAACTATATAATGCGGGGCGCTGAGAACCATGGAAATGGATGAGGAAATCTCATTTGGGGGCAGATGATAAGCCCTTTGAAAGGTTCAAGTGGAATCCTTGGACTGGAAACCCCCACCAAGCGGTATCTGGGATGGTGAAACGGGGCCGTTCCGTTGGGAATCCATAAAGGGGGGGGAAAAAATGGGGGTCTTTTTTTACTGCAAATTCCTTAAGGGGCCGCGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGTCCCAGCCG

Sequences - 3ʹ (reverse) EST

Accession: JZ837970
dbEST ID: 79655672
Trimmed Sequence: ACGGAAAAATCTGCCCAGCATCGCAGTCATGCCAGTTTTGAGCATCGAAACAGCTCCAGACGCAATCTCCATAGCAACAGCCCTCTCGCCTACTGCCACTACGGGCTGTGCCGCCAGCATTGCAGTTCCTCGGGCTGCTGTGGCTCCTAAGACACCACACACCCCGAAGCCTGCGGTGATGCCGACCCCAACGGCGTTCATTGTGAAACGTGTAGTAAAGTCATTACAGAACTTTTCTTGTATCTCCAGCAGTCTCACTTCTAGATCCTTCAGCATGGCGTCGTGACTCGAGGTGTTGCTGCCCTGTACAAACTGCATGAATTTCTCGAGGAGTTCTGAGAATTTTTGGGACACTTTCACCCGCATTGTGGGAGGCAGCGTTAGGGAAGACTGATTTTTCAAAAAATCCTGAAACTCGTTTTCAATTTCTCCCATGAGCTTTTGGTTCTTAATGGCGTANAACATCTCCATTGGGGAAGAGAAGCCATAAATTTGCAGATTAAGAACTTCCGTGAACTCCTGTAACATAGAAAATACGTGAGCAGAGGTCAATAACTCTCCATCTATATTCCTCTTAATATGCGTGCAGATCCCCCTAACTACCTTAAAGACATAGCTGCGCAAGGCTTTCCTGAAATTCTTCATCCTTGTCTTGGAGCGCTTCTTCCCTTCTCTCCAGTTATCCCCTTTGCCGGAAGGGGGGAGCAGAGAAAAACCCGGGCCGGGGTGGCGTGTGTGGGGCTCCCTAAAAACTTTTGGGGGGTAAACGGTTT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGGAAAAATCTGCCCAGCATCGCAGTCATGCCAGTTTTGAGCATCGAAACAGCTCCAGACGCAATCTCCATAGCAACAGCCCTCTCGCCTACTGCCACTACGGGCTGTGCCGCCAGCATTGCAGTTCCTCGGGCTGCTGTGGCTCCTAAGACACCACACACCCCGAAGCCTGCGGTGATGCCGACCCCAACGGCGTTCATTGTGAAACGTGTAGTAAAGTCATTACAGAACTTTTCTTGTATCTCCAGCAGTCTCACTTCTAGATCCTTCAGCATGGCGTCGTGACTCGAGGTGTTGCTGCCCTGTACAAACTGCATGAATTTCTCGAGGAGTTCTGAGAATTTTTGGGACACTTTCACCCGCATTGTGGGAGGCAGCGTTAGGGAAGACTGATTTTTCAAAAAATCCTGAAACTCGTTTTCAATTTCTCCCATGAGCTTTTGGTTCTTAATGGCGTANAACATCTCCATTGGGGAAGAGAAGCCATAAATTTGCAGATTAAGAACTTCCGTGAACTCCTGTAACATAGAAAATACGTGAGCAGAGGTCAATAACTCTCCATCTATATTCCTCTTAATATGCGTGCAGATCCCCCTAACTACCTTAAAGACATAGCTGCGCAAGGCTTTCCTGAAATTCTTCATCCTTGTCTTGGAGCGCTTCTTCCCTTCTCTCCAGTTATCCCCTTTGCCGGAAGGGGGGAGCAGAGAAAAACCCGGGCCGGGGTGGCGTGTGTGGGGCTCCCTAAAAACTTTTGGGGGGTAAACGGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGAAAAATCTGCCCAGCAT